Saturday, June 11, 2011
Be sure to ADD YOUR BLOG POST
Bloggerama Day event page http://www.facebook.com/event.php?eid=221323434553400
Far from the clinic, Tufts virologists draw ire
"In a letter to Science, Mikovits said she too is concerned about the inability of her peers to repeat her studies. But, she said that the journal's publication of an "editorial expression of concern" about her original findings would "be premature and would have a disastrous impact on the future of this field of science."
She also makes a plea:"Please do not proceed down a path that could be detrimental to the scientific exploration of human retroviruses in infectious disease, cancer, and, therefore, the future health of millions around the world."
* * *
The proofreader in me asks, how many different ways can they misspell Dr. Judy's last name?
Why they can't find XMRV
A fundamental error made by many of the scientists involved in the XMRV debate is they didn't pick the right fruit. Instead of cherries they wound up with rhubarb. They don't look the same and they don't taste the same but as far as some scientists are concerned, heck, they'll just have to do.
http://networkedblogs.com/j20MM
http://networkedblogs.com/j20MM
Many still suffer as we probe the cause of chronic fatigue
"The fallacy that the cause of chronic fatigue is psychological has set back much-needed research. It is only recently that the National Institutes of Health has approached it seriously. The Centers for Disease Control and Prevention has yet to mount an effective research program."
I’m Concerned About the Editorial Expression of Concern | No Poster
"what are the differences in the studies that have been done following on Lombardi, et al.? Here's a set of tables (PDF download), again authored by Judy Mikovits, noting only some the differences in some of the studies conducted thus far."
Friday, June 10, 2011
Ottawa 2011 Conference Details
Dear Friends:
The conference detailed agenda and registration information for both the medical professionals and patient/general public is now available at the website of the IACFS/ME at http://www.iamecfsme.org
There is also a FAQ for frequently asked questions conveniently placed on its Home Page.
You can register online,fax or mail in your registration forms along with payment. Either Canadian or American funds are accepted. Please make cheques payable to the IACFS/ME.
For updates on the conference, you can also visit the National ME/FM Action Network, host of the International IACFS/ME Conference at http://www.mefmaction.net
To contact the IACFS/ME by phone, call 847-258-7248
By Fax: 847-579-0975
Lydia
Lydia E. Neilson, M.S.M. , Founder
Lydia E. Neilson, M.S.M. , Founder
Chief Executive Officer
NATIONAL ME/FM ACTION NETWORK
512 - 33 Banner Road
Nepean, ON K2H 8V7 Canada
Tel. 613.829.6667
Fax 613.829.8518
Email: mefmaction@ncf.ca
NATIONAL ME/FM ACTION NETWORK - HOST OF THE IACFS/ME INTERNATIONAL RESEARCH & CLINICAL CONFERENCE - OTTAWA, CANADA
SEPTEMBER 22 - 25, 2011
For details on agendas and registration, please visit:
Member of www.iacfsme.org
Innovation and the XMRV Paradox
"Ultimately, innovation cannot work without both significant government support and a vibrant and dynamic private sector that allows people to experiment, fail and try again."
— Fareed Zakaria
— Fareed Zakaria
What ME/CFS needs is innovation.
In the 1980s, Dr. Jesse Stoff looked at his friend Charlie Pellegrino and said "I hope you like interesting diseases, because you've got one." And so much about this disease confounds Standard Medical Wisdom. Exercise doesn't make us feel better. Drugs often have the opposite effect (e.g., I've had sleeping pills keep me awake). Rest doesn't make us feel rested.
When I reported to one doctor that "exercising" my arm (using my hands to do things all day) resulted in paralytic muscle weakness at the end of the day, he asserted that this was "impossible", exercise should make the muscles stronger, not weaker, and wrote me off as a hypochondriac. Fortunately, I had a friend with polio, and knew her doctor had told her "preserve to conserve", it was absolutely expected that her arm muscles would start to fail from overuse. Exercising made her worse, just as it did me. I knew enough to take the advice of her specialist over my generalist. Limiting use of my hands is the key ... I stop when it starts to hurt.
Thankfully, patients and their families have funded a lot of innovative research, case in point, Whittemore Peterson Institute, which found the XMRV retrovirus.
And, thus far, WPI has won $65,000 from Chase Community Giving (possibly more to come if they're selected in the post-voting round for having the best purpose), which is a big help, could fund a few more studies, but is nowhere near the millions that other diseases get from the government.
We need "significant government support" – not $3.64 per patient, much of which is wasted on researching alleged psychiatric causes for a viral illness – to find the cause of ME/CFS. Some forms of cancer get $650 per patient for research. Why not us? Dr. Klimas has noted that we are more debilitated than late-stage cancer patients. But instead, she observes "these poor patients get nothing but attitude, they're patronized and have a poor standard of care. It's just not right. They're terribly ill and they deserve better than that."
This is a disease that costs the US economy $26,000,000,000 per year. A mere 1% of that would be $260 million. Throw that much at research in one year – proper medical research, not bogus psychiatric studies – and we can get a lot of patients back to work, recoup the expense in a matter of weeks. But they simply will not do that, because that would require admitting they've lied in the past about the nature of the illness.
They may think, and rightfully so, that admitting they lied might expose them to having to pay reparations. Decades of millions of lives wasted would not be inexpensive compensation. These patients became sick through no fault of their own (unlike AIDS or herpes, CFS is not a lifestyle disease), remained sick through no fault of their own (you can't get better if you're not getting proper medication), and many were denied Disability benefits because there was no blood test to prove they weren't just faking (due to refusal of the government to properly research the illness to create a blood test).
I See No Ships -- XMRV
"I see no ships" – attributed to Admiral Horatio Nelson after putting his spyglass to his blind eye
www.cfids-me.org/angliameaction/ships.html
www.cfids-me.org/angliameaction/ships.html
The politics of ME/CFS/XMRV require certain people to deny the existence of any objective evidence that patients are not just lazy or crazy. They wouldn't admit to seeing XMRV if it spit in their eye while they were looking straight at it.
Hillary J. Johnson, author of Osler's Web, commented that the name "Chronic Fatigue Syndrome" was selected "by a small group of politically motivated and/or poorly informed scientists and doctors who were vastly more concerned about costs to insurance companies and the Social Security Administration than about public health. Their deliberate intention – based on the correspondence they exchanged over a period of months – was to obfuscate the nature of the disease by placing it in the realm of the psychiatric rather than the organic."
Aside from the staggering costs to disability insurers if they had to pay out for ME/CFS/XMRV, there are too many people who have staked their careers on psychobabble; they (and their friends) are willing to continue to sacrifice the patients to keep their reputations and sizeable expert fees.
Since those with the most at stake (patients) are not the ones who are in the laboratories, and most of us have never run a virology experiment, it's easy for those who don't want to find proof that they're wrong to not find what they're not looking for. Laboratory science not being my strong suit, I have to trust the researchers at WPI when they point out that not a single true replication study has been done. Different "recipes" and different processes have been tried and (allegedly) failed, but no one has done exactly the same things in the same way as WPI.
"Allegedly" because I wouldn't put it past some of these clowns to doctor their results in order to report the result they wanted to find (or the government/insurance companies asked them to find).
Science, the journal that broke the XMRV news in 2009, has apparently caved to pressure from the Powers That Be and is asking Mikovits/Lombardi to retract the XMRV paper based on the number of people who aren't using the same method and therefore can't find the same result. FDA won't approve an anti-viral (Ampligen) for a disease CDC says doesn't exist, and Science won't let stand a paper proving that CDC is wrong. Dan Peterson has said this disease is all about politics ... in light of what's happened the past quarter-century, who can doubt him?
I have looked Dr. Judy in the eye from a distance measured in inches and she has assured me that the other studies haven't been done the same way and she stands behind her results.
I choose to believe Dr. Judy, who strikes me as honorable and reputable, intelligent, and with the backbone to stand up to the male establishment who couldn't stand it that they were scooped in the 1990s by Elaine DeFreitas and are irked again that another woman has found what they couldn't with XMRV.
Eventually, the truth will be accepted, that there is such a thing as XMRV, and it's not a lab contaminant. The only contamination here is the nonsense being spread by those who refuse to accept the truth that XMRV exists.
Whether it turns out that XMRV causes CFS or is just an opportunistic infection that takes advantage of CFS patients' ineffective immune systems isn't something I have the proper education to guess. But I don't have to guess at it that the WPI lab found XMRV in a majority of CFS patients. And it makes sense to me that people don't develop antibodies to lab contaminants. But what do I know? I studied law, not medicine.
Most importantly: What seems to fall off the radar of some of the denialists is that in the same published paper XMRV was also implicated, by the reputable National Cancer Institute, in prostate cancer. The attacks on XMRV are directed only at CFS and the upstart WPI. I have not seen a single study claiming that men with cancer are also just imagining things. No one is trying to debunk the XMRV/cancer link. Why is that?
The fact that an opinion has been widely held is no evidence whatever that it is not utterly absurd.
— Bertrand Russell
— Bertrand Russell
XMRV, Contamination, and Loss of Prestige
To whom it may concern,
Post Viral Fatigue Syndrome (PVFS) is categorised by the World Health
Organisation (WHO) in the 10th edition of the International
Classification of Diseases (ICD-10) as a physical/neurological illness
in section G93.3 (ICD-10-G93.3) where it is also listed as Benign
Myalgic Encephalomyelitis or ME. The WHO acknowledge that the term
Chronic Fatigue Syndrome is used as a 'colloquial reference' to
PVFS/ME[1]. There are many thousands of peer-reviewed scientific papers
underpinning the biomedical nature of PVFS/ME(CFS). Unfortunately
however, there is a long, dirty and well-documented history of political
vested interests skewing the scientific process as far as PVFS/ME(CFS) is concerned[2]. The experience of the ME community in this respect is
far from unique[3] but few other patient groups and associated
medical/research professionals have had to put up with quite the degree
of sustained adverse political lobbying and assault that afflicts the
field of PVFS/ME(CFS).
In May 2011, Editors of the prestigious journal 'Science' asked the
co-authors of the 2009 paper that linked Chronic Fatigue Syndrome to
infection with a gamma retrovirus, known as XMRV[4], to voluntarily
retract the paper[5] following other studies that have failed to detect
the retrovirus. Dr Judy Mikovits, one of the 'Science' XMRV paper's key
authors has robustly refused to retract: citing the fact that other
studies have indeed found evidence of human gamma retrovirus infection, that no study to date has replicated or disproved her original research, that other major scientific investigation into gamma retrovirus infection is ongoing and that the science on the matter is very far from
settled[6]. Following the extraordinary request of the 'Science' journal
editors, the scientific literature, established media and the internet
have, not surprisingly, been awash with heated and detailed comment,
claim and counter-claim. However, two key points that seem to be
understated or lost altogether in coverage by much of the established
media are:
1. If human gamma retrovirus infection was not really present in in subjects studied and findings were simply an erroneous laboratory contamination issue then how on earth have more than one group of
researchers found significantly more such alleged 'contamination' in patient subjects than control subjects? This simply defies logic.
2. Until the research techniques and patient selection criteria used in
the original Lombardi and Mikovits et al study have been properly and
independently replicated and shown to be both seriously flawed and
indicative of malpractice there should be absolutely no question of
their paper being withdrawn from the journal 'Science'. Premature and
unwarranted calls for such retraction defies professionalism.
In taking the precipitous and extraordinary action that they have
regarding said Lombardi and Mikovits study, the editors of 'Science'
have opened themselves up to the accusation that they are caught up in a
very different 'contamination' issue to the one they write about. Namely
the contamination of what should be independent scientific editorial
with undue political considerations.
The editors now stand accused of having caved-in to behind-the-scenes
pressure. Pressure that has absolutely nothing to do with genuine
science but everything to do with political lobbying by vested
interests. The 'Science' journal is often described as being one of the
most "prestigious" in its field. It is now viewed by many to have sunk
to the level of the gutter press. In my opinion it is the editors of
'Science' that need to retract, not Lombardi and Mikovits et al.
Anglia ME Action
June 2011
contact@angliameaction.org.uk
ENDNOTES:
[1] http://www.who.int/classifications/icd/en/
For accuracy, full reference needs to be made to the three-volume
published/book version of ICD 10 (especially the alphabetical
index/volume 3 as well as the tabular list/volume 1) and additional WHO
comment as comprehensive coverage of the ICD is not given on the WHO
website. The bibliographic details of all three ICD-10 volumes are:
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 1 -- Tabular
List -- ISBN: 92 4 154649 2.
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 2 --
Instruction Manual -- ISBN: 92 4 154653 0.
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 3 --
Alphabetical Index -- ISBN: 92 4 154654 9.
[2] See, for example, documents at the following URLs:
http://www.meactionuk.org.uk/Comments-on-PDW-letter-re-PACE.htm
http://www.meactionuk.org.uk/COMPLAINT-to-Lancet-re-PACE.htm
http://www.meactionuk.org.uk/magical-medicine.htm
http://www.meactionuk.org.uk/Corporate_Collusion_2.htm
[3] See for example: Professor Bruce Charlton -- Zombie Science -- a
sinister consequence of evaluating scientific theories purely on the
basis of enlightened self-interest, Medical Hypotheses (2008) 71
327-329, DOI: 10.1016/j.mehy.2008.05.018:
http://medicalhypotheses.blogspot.com/2008/07/zombie-science-dead-but-wont-lie-down.html
[4] Lombardi VC, Ruscetti FW, Das Gupta J, /et al./ (October 2009).
"Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients
with Chronic Fatigue Syndrome". /Science/ *326* (5952): 585--9.
doi:10.1126/science.1179052. PMID
19815723<http://www.ncbi.nlm.nih.gov/pubmed/19815723>.
http://www.sciencemag.org/content/326/5952/585
[5] Editorial Expression of Concern, Science Express, Published Online
31 May 2011. Science DOI: 10.1126/science.1208542
http://www.sciencemag.org/content/early/2011/05/31/science.1208542.abstract
http://www.sciencemag.org/content/early/2011/05/31/science.1208542.abstract
http://www.sciencemag.org/content/326/5952/585.full.pdf
Also see Wall Street Journal comment at:
http://online.wsj.com/article/SB10001424052702303745304576355852212887170.html
[6] http://www.wpinstitute.org/news/docs/WPI_pressrel_053111.pdf
http://www.wpinstitute.org/news/docs/FinalreplytoScienceWPI.pdf
[--- PERMISSION TO REPOST---]
Post Viral Fatigue Syndrome (PVFS) is categorised by the World Health
Organisation (WHO) in the 10th edition of the International
Classification of Diseases (ICD-10) as a physical/neurological illness
in section G93.3 (ICD-10-G93.3) where it is also listed as Benign
Myalgic Encephalomyelitis or ME. The WHO acknowledge that the term
Chronic Fatigue Syndrome is used as a 'colloquial reference' to
PVFS/ME[1]. There are many thousands of peer-reviewed scientific papers
underpinning the biomedical nature of PVFS/ME(CFS). Unfortunately
however, there is a long, dirty and well-documented history of political
vested interests skewing the scientific process as far as PVFS/ME(CFS) is concerned[2]. The experience of the ME community in this respect is
far from unique[3] but few other patient groups and associated
medical/research professionals have had to put up with quite the degree
of sustained adverse political lobbying and assault that afflicts the
field of PVFS/ME(CFS).
In May 2011, Editors of the prestigious journal 'Science' asked the
co-authors of the 2009 paper that linked Chronic Fatigue Syndrome to
infection with a gamma retrovirus, known as XMRV[4], to voluntarily
retract the paper[5] following other studies that have failed to detect
the retrovirus. Dr Judy Mikovits, one of the 'Science' XMRV paper's key
authors has robustly refused to retract: citing the fact that other
studies have indeed found evidence of human gamma retrovirus infection, that no study to date has replicated or disproved her original research, that other major scientific investigation into gamma retrovirus infection is ongoing and that the science on the matter is very far from
settled[6]. Following the extraordinary request of the 'Science' journal
editors, the scientific literature, established media and the internet
have, not surprisingly, been awash with heated and detailed comment,
claim and counter-claim. However, two key points that seem to be
understated or lost altogether in coverage by much of the established
media are:
1. If human gamma retrovirus infection was not really present in in subjects studied and findings were simply an erroneous laboratory contamination issue then how on earth have more than one group of
researchers found significantly more such alleged 'contamination' in patient subjects than control subjects? This simply defies logic.
2. Until the research techniques and patient selection criteria used in
the original Lombardi and Mikovits et al study have been properly and
independently replicated and shown to be both seriously flawed and
indicative of malpractice there should be absolutely no question of
their paper being withdrawn from the journal 'Science'. Premature and
unwarranted calls for such retraction defies professionalism.
In taking the precipitous and extraordinary action that they have
regarding said Lombardi and Mikovits study, the editors of 'Science'
have opened themselves up to the accusation that they are caught up in a
very different 'contamination' issue to the one they write about. Namely
the contamination of what should be independent scientific editorial
with undue political considerations.
The editors now stand accused of having caved-in to behind-the-scenes
pressure. Pressure that has absolutely nothing to do with genuine
science but everything to do with political lobbying by vested
interests. The 'Science' journal is often described as being one of the
most "prestigious" in its field. It is now viewed by many to have sunk
to the level of the gutter press. In my opinion it is the editors of
'Science' that need to retract, not Lombardi and Mikovits et al.
Anglia ME Action
June 2011
contact@angliameaction.org.uk
ENDNOTES:
[1] http://www.who.int/classifications/icd/en/
For accuracy, full reference needs to be made to the three-volume
published/book version of ICD 10 (especially the alphabetical
index/volume 3 as well as the tabular list/volume 1) and additional WHO
comment as comprehensive coverage of the ICD is not given on the WHO
website. The bibliographic details of all three ICD-10 volumes are:
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 1 -- Tabular
List -- ISBN: 92 4 154649 2.
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 2 --
Instruction Manual -- ISBN: 92 4 154653 0.
- International Statistical Classification of Diseases and Related
Health Problems - Tenth Revision -- Second Edition: Volume 3 --
Alphabetical Index -- ISBN: 92 4 154654 9.
[2] See, for example, documents at the following URLs:
http://www.meactionuk.org.uk/Comments-on-PDW-letter-re-PACE.htm
http://www.meactionuk.org.uk/COMPLAINT-to-Lancet-re-PACE.htm
http://www.meactionuk.org.uk/magical-medicine.htm
http://www.meactionuk.org.uk/Corporate_Collusion_2.htm
[3] See for example: Professor Bruce Charlton -- Zombie Science -- a
sinister consequence of evaluating scientific theories purely on the
basis of enlightened self-interest, Medical Hypotheses (2008) 71
327-329, DOI: 10.1016/j.mehy.2008.05.018:
http://medicalhypotheses.blogspot.com/2008/07/zombie-science-dead-but-wont-lie-down.html
[4] Lombardi VC, Ruscetti FW, Das Gupta J, /et al./ (October 2009).
"Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients
with Chronic Fatigue Syndrome". /Science/ *326* (5952): 585--9.
doi:10.1126/science.1179052. PMID
19815723<http://www.ncbi.nlm.nih.gov/pubmed/19815723>.
http://www.sciencemag.org/content/326/5952/585
[5] Editorial Expression of Concern, Science Express, Published Online
31 May 2011. Science DOI: 10.1126/science.1208542
http://www.sciencemag.org/content/early/2011/05/31/science.1208542.abstract
http://www.sciencemag.org/content/early/2011/05/31/science.1208542.abstract
http://www.sciencemag.org/content/326/5952/585.full.pdf
Also see Wall Street Journal comment at:
http://online.wsj.com/article/SB10001424052702303745304576355852212887170.html
[6] http://www.wpinstitute.org/news/docs/WPI_pressrel_053111.pdf
http://www.wpinstitute.org/news/docs/FinalreplytoScienceWPI.pdf
[--- PERMISSION TO REPOST---]
XMRV is a recombinant virus
XMRV is a recombinant virus from mice
31 MAY 2011
The novel human retrovirus XMRV has been associated with prostate
cancer and chronic fatigue syndrome. The nucleotide sequence of XMRV
isolated from humans indicates that the virus is nearly identical with
XMRV produced from a human prostate tumor cell line called 22Rv1. This
cell line was derived by passage of human prostate tumor tissue in
nude mice. Sequence analyses reveal that the genomes of these mouse
strains contain two different proviral DNAs related to XMRV. These
viral genomes recombined to produce XMRV that has been isolated from
humans.
XMRV was originally isolated from a human prostate cancer in 2006, and
subsequently associated with ME/CFS. The human cell line 22Rv1, which
was established from a human prostate tumor (CWR22), produces
infectious XMRV. An important question is whether XMRV was present in
the original prostate tumor, or was obtained by passage through nude
mice. To answer this question, DNA from various passages of the
prostate tumor in nude mice (called xenografts), and the mouse strains
used to passage the tumor, were analyzed for the presence of XMRV
proviral DNA.
Early-passage xenografts did not contain XMRV, but mouse cells found
in them did contain two related proviruses called PreXMRV-1 and
PreXMRV-2. The 3'-3211 nucleotides of PreXMRV-1, and both LTRs, are
identical to XMRV save for two nucleotide differences. The genomic
5'-half of XMRV and PreXMRV-1 differs by 9-10%. PreXMRV-1 is defective
for replication due to mutations in genes encoding the gag and pol
proteins. PreXMRV-2 does not contain obvious mutations that would
prevent the production of infectious viruses. The gag-pro-pol and a
part of the env region of this viral genome is identical to that of
XMRV save for two base differences; the LTRs and the remainder of the
genome differ by 6-12% from XMRV.
Comparison of the sequences of PreXMRV-1 and PreXMRV-2 indicates that
recombination between the two viral genomes led to the formation of
XMRV. When the sequences of PreXMRV-1 and -2 are used to construct the
recombinant XMRV, the resulting virus differs by only 4 nucleotides
from the consensus XMRV sequence derived from all human isolates
reported to date.
The nude mice used for passage of the original prostate tumor were
likely the NU/NU and Hsd strains. Neither mouse strain contains XMRV
proviral DNA, but both contain PreXMRV-1 and PreXMRV-2 proviral DNA.
These data demonstrate that XMRV was not present in the original CWR22
prostate tumor, but arose by recombination of PreXMRV-1 and PreXMRV-2
between 1993-1996. When the original prostate tumor was implanted into
nude mice, some of the mice harbored both pre-XMRV-1 and -2 endogenous
proviruses, which recombined to form XMRV. The authors believe that
XMRV originating from the CRWR22 xenografts, the22Rv1 cell line, or
other related cell lines has contaminated all human samples positive
for the virus. In addition, they suggest that PCR assays for XMRV may
actually detect PreXMRV-1 and -2 or other endogenous viral DNA from
contaminating mouse DNA.
Another possibility to explain the origin of XMRV is that it arose in
mice and can infect humans. If this is true, then XMRV would have to
be present in the nude mice used to passage the CWR22 human prostate
tumor. No evidence for an XMRV provirus was found in 12 different nude
mouse strains, including two used to passage the CWR22 tumor.
Furthermore, a screen of 89 inbred and wild mice failed to reveal the
presence of proviral XMRV DNA. Hence the authors conclude:
...that XMRV arose from a recombination event between two endogenous
MLVs that took place around 1993-1996 in a nude mouse carrying the
CWR22 PC xenograft, and that all of the XMRV isolates reported to date
are descended from this one event.
It is possible that XMRV produced during passage of CWR22 in nude mice
subsequently infected humans. Because XMRV arose between 1993-1996, this scenario could not explain cases of prostate cancer and chronic fatigue syndrome that arose prior to that date.
How can these findings be reconciled with the published evidence that sera of ME/CFS patients from the 1980s contain antibodies to XMRV?
Those antibodies were not shown to be directed specifically against
XMRV, and therefore cannot be used to prove that XMRV circulated in
humans prior to 1993-96. Furthermore, in the absence of clear
isolation of an infectious virus, antibody tests alone have proven
highly unreliable for identification of new viruses.
Where do these findings leave the hypothesis that XMRV is the
etiologic agent of prostate cancer and ME/CFS? All published sequences
of human XMRV isolates are clearly derived by recombination of
PreXMRV-1 and -2. The finding of human XMRV isolates that are not
derived from PreXMRV-1 and -2 would leave a role for XMRV in human
disease. As of this writing, no such XMRV isolates have been reported
in the scientific literature.
Update: A second paper has also been published in Science Express
today entitled "No evidence of murine-like gammaretroviruses in CFS
patients previously identified as XMRV-infected". Editors of the
journal Science have asked the authors to retract their 2009 paper
linking XMRV infection with chronic fatigue syndrome. The authors have
refused.
T. Paprotka, K. A. Delviks-Frankenberry, O. Cingoz, A. Martinez, H.-J.
Kung, C.G. Tepper, W-S Hu, M. J. Fivash, J.M. Coffin, & V.K. Pathak
(2011). Recombinant origin of the retrovirus XMRV. Science Express
www.virology.ws
31 MAY 2011
The novel human retrovirus XMRV has been associated with prostate
cancer and chronic fatigue syndrome. The nucleotide sequence of XMRV
isolated from humans indicates that the virus is nearly identical with
XMRV produced from a human prostate tumor cell line called 22Rv1. This
cell line was derived by passage of human prostate tumor tissue in
nude mice. Sequence analyses reveal that the genomes of these mouse
strains contain two different proviral DNAs related to XMRV. These
viral genomes recombined to produce XMRV that has been isolated from
humans.
XMRV was originally isolated from a human prostate cancer in 2006, and
subsequently associated with ME/CFS. The human cell line 22Rv1, which
was established from a human prostate tumor (CWR22), produces
infectious XMRV. An important question is whether XMRV was present in
the original prostate tumor, or was obtained by passage through nude
mice. To answer this question, DNA from various passages of the
prostate tumor in nude mice (called xenografts), and the mouse strains
used to passage the tumor, were analyzed for the presence of XMRV
proviral DNA.
Early-passage xenografts did not contain XMRV, but mouse cells found
in them did contain two related proviruses called PreXMRV-1 and
PreXMRV-2. The 3'-3211 nucleotides of PreXMRV-1, and both LTRs, are
identical to XMRV save for two nucleotide differences. The genomic
5'-half of XMRV and PreXMRV-1 differs by 9-10%. PreXMRV-1 is defective
for replication due to mutations in genes encoding the gag and pol
proteins. PreXMRV-2 does not contain obvious mutations that would
prevent the production of infectious viruses. The gag-pro-pol and a
part of the env region of this viral genome is identical to that of
XMRV save for two base differences; the LTRs and the remainder of the
genome differ by 6-12% from XMRV.
Comparison of the sequences of PreXMRV-1 and PreXMRV-2 indicates that
recombination between the two viral genomes led to the formation of
XMRV. When the sequences of PreXMRV-1 and -2 are used to construct the
recombinant XMRV, the resulting virus differs by only 4 nucleotides
from the consensus XMRV sequence derived from all human isolates
reported to date.
The nude mice used for passage of the original prostate tumor were
likely the NU/NU and Hsd strains. Neither mouse strain contains XMRV
proviral DNA, but both contain PreXMRV-1 and PreXMRV-2 proviral DNA.
These data demonstrate that XMRV was not present in the original CWR22
prostate tumor, but arose by recombination of PreXMRV-1 and PreXMRV-2
between 1993-1996. When the original prostate tumor was implanted into
nude mice, some of the mice harbored both pre-XMRV-1 and -2 endogenous
proviruses, which recombined to form XMRV. The authors believe that
XMRV originating from the CRWR22 xenografts, the22Rv1 cell line, or
other related cell lines has contaminated all human samples positive
for the virus. In addition, they suggest that PCR assays for XMRV may
actually detect PreXMRV-1 and -2 or other endogenous viral DNA from
contaminating mouse DNA.
Another possibility to explain the origin of XMRV is that it arose in
mice and can infect humans. If this is true, then XMRV would have to
be present in the nude mice used to passage the CWR22 human prostate
tumor. No evidence for an XMRV provirus was found in 12 different nude
mouse strains, including two used to passage the CWR22 tumor.
Furthermore, a screen of 89 inbred and wild mice failed to reveal the
presence of proviral XMRV DNA. Hence the authors conclude:
...that XMRV arose from a recombination event between two endogenous
MLVs that took place around 1993-1996 in a nude mouse carrying the
CWR22 PC xenograft, and that all of the XMRV isolates reported to date
are descended from this one event.
It is possible that XMRV produced during passage of CWR22 in nude mice
subsequently infected humans. Because XMRV arose between 1993-1996, this scenario could not explain cases of prostate cancer and chronic fatigue syndrome that arose prior to that date.
How can these findings be reconciled with the published evidence that sera of ME/CFS patients from the 1980s contain antibodies to XMRV?
Those antibodies were not shown to be directed specifically against
XMRV, and therefore cannot be used to prove that XMRV circulated in
humans prior to 1993-96. Furthermore, in the absence of clear
isolation of an infectious virus, antibody tests alone have proven
highly unreliable for identification of new viruses.
Where do these findings leave the hypothesis that XMRV is the
etiologic agent of prostate cancer and ME/CFS? All published sequences
of human XMRV isolates are clearly derived by recombination of
PreXMRV-1 and -2. The finding of human XMRV isolates that are not
derived from PreXMRV-1 and -2 would leave a role for XMRV in human
disease. As of this writing, no such XMRV isolates have been reported
in the scientific literature.
Update: A second paper has also been published in Science Express
today entitled "No evidence of murine-like gammaretroviruses in CFS
patients previously identified as XMRV-infected". Editors of the
journal Science have asked the authors to retract their 2009 paper
linking XMRV infection with chronic fatigue syndrome. The authors have
refused.
T. Paprotka, K. A. Delviks-Frankenberry, O. Cingoz, A. Martinez, H.-J.
Kung, C.G. Tepper, W-S Hu, M. J. Fivash, J.M. Coffin, & V.K. Pathak
(2011). Recombinant origin of the retrovirus XMRV. Science Express
www.virology.ws
* * *
I am from the "Class of 1987", before the alleged first date of XMRV.....
XMRV & CFS - the story continues
June 7, 2011
Murine Viruses and Chronic Fatigue: Does the Story Continue
Posted by Derek
Well, one day after writing an obit for the XMRV
story comes this abstract (http://bit.ly/lFNUiC)
from Retrovirology.
The authors, from Cornell and SUNY-Buffalo, say
that they've detected other murine retrovirus
transcripts from CFS patients (but not in most
controls), and that these are more similar to
those reported in last year's Lo and Alter paper in
PNAS (http://bit.ly/j8LDj9) than they are to XMRV
itself.
So perhaps the story continues, and what a mess
it is at this point. I continue to think that the
XMRV hypothesis itself is in serious trouble, but
murine retroviruses as a class are still worth
following up on.
This is tough work, though, because of the twin
problems of detection and contamination, and it's
going to be easy for people to fool themselves.
Meanwhile, Retraction Watch has more
(http://bit.ly/lzSWuo) on Science's *Expression of
Concern* that I wrote about yesterday.
It appears that the journal asked the authors to
retract the paper (so says the Wall Street Journal,
anyway) but that co-author Judy Mikovits turned
them down (as might have been expected from
her previous stands (http://bit.ly/mfzl46) in this
area).
Science released their editorial note early because
of the WSJ piece.
Murine Viruses and Chronic Fatigue: Does the Story Continue
Posted by Derek
Well, one day after writing an obit for the XMRV
story comes this abstract (http://bit.ly/lFNUiC)
from Retrovirology.
The authors, from Cornell and SUNY-Buffalo, say
that they've detected other murine retrovirus
transcripts from CFS patients (but not in most
controls), and that these are more similar to
those reported in last year's Lo and Alter paper in
PNAS (http://bit.ly/j8LDj9) than they are to XMRV
itself.
So perhaps the story continues, and what a mess
it is at this point. I continue to think that the
XMRV hypothesis itself is in serious trouble, but
murine retroviruses as a class are still worth
following up on.
This is tough work, though, because of the twin
problems of detection and contamination, and it's
going to be easy for people to fool themselves.
Meanwhile, Retraction Watch has more
(http://bit.ly/lzSWuo) on Science's *Expression of
Concern* that I wrote about yesterday.
It appears that the journal asked the authors to
retract the paper (so says the Wall Street Journal,
anyway) but that co-author Judy Mikovits turned
them down (as might have been expected from
her previous stands (http://bit.ly/mfzl46) in this
area).
Science released their editorial note early because
of the WSJ piece.
How can XMRV contaminate some samples but not others?
To sort out the controversy over the XMRV virus and Chronic Fatigue Syndrome, a key question is - how is it possible (or is it possible) that some researchers claim that they find CFS patients' blood test samples to be "contaminated" with XMRV, but claim blood samples tested from healthy people is not contaminated with XMRV ? That seems to make no sense. Yet is being used by some researchers to claim XMRV is not involved in CFS in any way. How can the CFS patients blood be contaminated with XMRV but not the healthy people's blood? Is this incompetence, fraud, conspiracy or what? What is the truthful answer to this key and rightfully suspicious question?
XMRV abstracts from Retrovirus Conference
http://www.retrovirology.com/supplements/8/S1
15th International Conference on Human Retroviruses: HTLV and Related Viruses
Table of contents-
http://www.biomedcentral.com/content/pdf/1742-4690-8-S1-info.pdf
XMRV abstracts (not all are on XMRV)- A207-A243 Endogenous Viruses,
Foamy Viruses and XMRV
http://www.retrovirology.com/content/pdf/1742-4690-8-S1-A1.pdf
15th International Conference on Human Retroviruses: HTLV and Related Viruses
Table of contents-
http://www.biomedcentral.com/content/pdf/1742-4690-8-S1-info.pdf
XMRV abstracts (not all are on XMRV)- A207-A243 Endogenous Viruses,
Foamy Viruses and XMRV
http://www.retrovirology.com/content/pdf/1742-4690-8-S1-A1.pdf
XMRV Podcast
The podcast This Week in Virology, aka TWiV, has dedicated an entire
show to questions about XMRV.
--------------------------------------------------------------------------------------------
http://www.virology.ws/2011/06/05/twiv-136-exit-xmrv/
TWiV 136: Exit XMRV
5 June 2011
Hosts: Vincent Racaniello, Alan Dove, Rich Condit, and Stephen Goff
Retrovirologist Stephen Goff joins Vincent, Rich, and Alan for a
discussion of recent papers on the retrovirus XMRV and its association
with chronic fatigue syndrome and prostate cancer.
show to questions about XMRV.
--------------------------------------------------------------------------------------------
http://www.virology.ws/2011/06/05/twiv-136-exit-xmrv/
TWiV 136: Exit XMRV
5 June 2011
Hosts: Vincent Racaniello, Alan Dove, Rich Condit, and Stephen Goff
Retrovirologist Stephen Goff joins Vincent, Rich, and Alan for a
discussion of recent papers on the retrovirus XMRV and its association
with chronic fatigue syndrome and prostate cancer.
Sexual transmission of XMRV
http://www.hindawi.com/journals/av/aip/965689.pdf
Sexual transmission of XMRV:a potential infection route
Prachi Sharma, Kenneth Rogers, Suganthi Suppiah, Ross Ross Molinaro
Ross J. Molinaro, Nattawat Onlamoon, J. Hackett Jr., G. Schochetman,
Eric A. Klein, Robert Silverman, and F. Villinger
Received 27 April 2011; Accepted 25 May 2011
Abstract
Although XMRV dissemination in humans is a matter of debate, the
prostate of select patients seem to harbor XMRV, which raises
questions about its potential route of transmission. We established a
model of infection in rhesus macaques inoculated with XMRV. In spite
of the intravenous inoculation, all infected macaques exhibited
readily detectable XMRV signal in the reproductive tract of all 4
males and 1 female during both acute and chronic infection stages.
XMRV showed explosive growth in the acini of prostate during acute but
not chronic infection. In seminal vesicles, epididymis and testes,
XMRV protein production was detected throughout infection in
interstitial or epithelial cells. In the female monkey, epithelial
cells in the cervix and vagina were also positive for XMRV gag. The
ready detection of XMRV in the reproductive tract of male and female
macaques infected intravenously, suggests the potential for sexual
transmission for XMRV.
Sexual transmission of XMRV:a potential infection route
Prachi Sharma, Kenneth Rogers, Suganthi Suppiah, Ross Ross Molinaro
Ross J. Molinaro, Nattawat Onlamoon, J. Hackett Jr., G. Schochetman,
Eric A. Klein, Robert Silverman, and F. Villinger
Received 27 April 2011; Accepted 25 May 2011
Abstract
Although XMRV dissemination in humans is a matter of debate, the
prostate of select patients seem to harbor XMRV, which raises
questions about its potential route of transmission. We established a
model of infection in rhesus macaques inoculated with XMRV. In spite
of the intravenous inoculation, all infected macaques exhibited
readily detectable XMRV signal in the reproductive tract of all 4
males and 1 female during both acute and chronic infection stages.
XMRV showed explosive growth in the acini of prostate during acute but
not chronic infection. In seminal vesicles, epididymis and testes,
XMRV protein production was detected throughout infection in
interstitial or epithelial cells. In the female monkey, epithelial
cells in the cervix and vagina were also positive for XMRV gag. The
ready detection of XMRV in the reproductive tract of male and female
macaques infected intravenously, suggests the potential for sexual
transmission for XMRV.
* * *
One more thing to "thank" my ex for?
XMRV and Ampligen
One must wonder whether those who are calling for the retraction of the XMRV paper have read this?
HUNTER HOPKINS CENTER Hunter-Hopkins ME-letter March 2011
Hunter-Hopkins Center, P.A.
7421 Carmel Executive Park Drive, Suite 320
Charlotte, North Carolina 28226
Tel. (704) 543 9692 · Fax. (704) 543 8547
7421 Carmel Executive Park Drive, Suite 320
Charlotte, North Carolina 28226
Tel. (704) 543 9692 · Fax. (704) 543 8547
Contents XMRV & AMPLIGEN
A Report from the 9th Hemispherx Biopharma Investigators Meeting March 3-6, 2011
*Gene Sequencing in Persons with CFS
*XMRV Subset Analysis and Ampligen Treatment
*What Is Ampligen?
*XMRV Subset Analysis and Ampligen Treatment
*What Is Ampligen?
Gene Sequencing in Persons with CFS Wendy Fallick, our research coordinator, and I have just returned from the 9th Investigators Meeting sponsored by Hemispherx Biopharma, makers of Ampligen and Alferon.
This was perhaps the most exciting of these meetings that I have attended, and I suspect that information relayed this past week to us will change the field of medicine forever. I want to share that information with you.
Recall that Lombardi, Mikovits, et alia published a paper in the October 2009 Science journal describing a novel retrovirus in 67% of 101 patients with CFS, using a PCR (polymerase chain reaction) test.
By checking for antibodies, viral protein, and direct viral culture they were able to demonstrate this virus in 95-98% of PWCs (persons with CFS).
This virus was called XMRV because of its special characteristics: Xenotropic because it first developed in another animal species but now infected only humans; Murine because it first developed in mice; and RetroVirus because it replicated backwards unlike most other viruses.
In fact, XMRV was related to a family of murine leukemia viruses, or MLVs.
The Science paper was followed by several other reports that the virus was not found in other cohorts, and confidence in the Lombardi-Mikovits report was waning.
Then Drs. Lo and Alter published a 2010 paper that identified by PCR a similar retrovirus in 86.5% of persons with CFS that they had studied.
The viruses that they identified were MLVs, only 2-3 base pairs (.00025 %) different from Lombardi's XMRV.
This difference has been explained as a "shift" in the genome attributed to time and distance. That is, over time viruses tend to mutate slightly, and it is not exceptional for viruses from one geographical region (Lombardi/Mikovits on the West Coast) to differ slightly from those in another region (Lo/Alter, East Coast).
This was seen, for example, in the 2009 swine flu epidemic where over 50 different strains of H1N1 were identified from Hong Kong, Singapore, Malaysia, etc.
There are two retroviruses thought to be pathogenic in man:
HTLV Human T-Lymphotrophic Virus(4 strains but only 1 is harmful to man)
HIV Human Immunodeficiency Virus(2 strains but only one causes AIDS)
And now we have to add MRVs or MLVs (Murine Retroviruses or Murine Leukemia Viruses) to the list. There are several strains of MLVs of which XMRV is one strain.
Which strains are pathogenic in man has not yet been determined, although XMRV has been linked to familial prostate cancer at the least.
Let's turn for a second to a schematic representation of DNA and XMRV. DNA is made up of two twisted strands of nucleic acids strung together like beads. Only 4 nucleic acids are involved: Adenine, Cytosine, Guanine, and Thymine – or A,C,G and T – and their pattern along a single strand of DNA might look like :
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
XMRV is an RNA virus, or strand of nucleotide sequences very much like a single strand of DNA. Sections of each strand are named for their specific functions. A strand of XMRV may be represented as :
5' |Text Box: LTRUSgagpolenvU3LTR| 3'
Notice that there is a head ("five prime") and a tail ("three prime") and both ends are marked by a section called the "long terminal repeat" or LTR.
Most viruses replicate themselves starting from the 5'end to the 3' end. Retroviruses, however, use "reverse transcriptase (RT)" to replicate backwards (retro) inside a host cell to form a strand of DNA. This strand then incorporates itself into the host's own genomic DNA by an enzyme called "integrase."
Thus human DNA +XMRV ends up looking like:
ACGTACGTACGTACGTLTRUSgagpolenvU3LTRCGTACGTACGTACGTACGT
This new combination DNA is called a "chimera." Now human DNA contains millions of nucleotides, and XMRV only contains about 8000 nucleotides, so the chimera is not as easy to spot as it appears here.
Incorporated into your genome like this the virus may take control of the cell, manufacture abnormal proteins, and– in the case of XMRV –kill the cell. This latter event is called "apoptosis."
Lastly, unlike the HIV retrovirus that multiplies rapidly and millions can be found in a single drop of blood, XMRV replicates slowly and is present in only very small amounts in the peripheral blood.
These characteristics of XMRV can explain several observations:
Very few XMRV particles are found in a blood sample and it may take multiple samples to find them
Inside the cell and/or chimera, the XMRV is relatively protected from detection by the immune system and many blood tests
*When PWCs are very sick their white blood cell populations decrease (due to apoptosis)
*The XMRV particle is so small it can infiltrate virtually any part of the body and any system
*Why researchers are finding abnormal proteins in the blood and CSF of PWCs (proteomics)
Now, here is the most intriguing part of our Hemispherx meeting. It took hundreds of scientists at multiple sites ten years to map out the 3 billion nucleotides in the normal human genome.
Dr. Carter introduced us to Howard Urnovitz, CEO of Chronix Biomedical. Urnovitz revealed that his research group is able to map genomes at a very rapid pace.
He expects that in the near future, Chronix will be able to map your entire genome in under six hours and for probably less than a $100 fee.
This is StarTrek medicine!
Urnovitz went on to explain that when apoptosis occurs, chimeras are spilled into the blood stream and can be extracted easily by his laboratory. When his lab examined the genomes of persons with CFS they found chimeras made up of XMRV genes (but oddly missing their LTR regions)..
This technology is wonderful news for PWCs because if XMRV or MLV can be clearly shown to cause CFS, then we will have an inexpensive and unique marker for the disorder!
The Chronix test is not currently available commercially, but Hemispherx plans to explore the use of this technology in future studies.
Subset Analysis and Ampligen Treatment
Dr. David Strayer, Medical Director at Hemipsherx Biopharma, described a retrospective study of the response to Ampligen in subjects who were positive or negative for XMRV.
XMRV was tested at VIP Labs, which is associated with the Whittemore-Peterson Institute, and used similar techniques as those employed by Dr. Mikovits at the WPI.
In one study, serum from 208 subjects from a previous double blind placebo controlled Ampligen study were analyzed for XMRV.
About one third were positive for the virus and two-thirds were not.
Activity monitoring demonstrated less activity in XMRV+ subjects. That is, they were less active and presumably more ill.
Specifically, the improvement in exercise ability was monitored in these subjects. More improvement was measured in XMRV+ subjects than in XMRV-subjects.
The table below describes the percentage of subjects who obtained at least 25% improvement in treadmill exercise duration at week 40 of treatment, as related to XMRV serology:
----------------------------------------------------------------
XMRV Status``|Improved``|`Improved````|Difference
``````````````on Ampligen``with placebo``(AMP-PBO)
----------------------------------------------------------------
Pos (n=81)``````44.7%```````17.6%``````27.1%
----------------------------------------------------------------
Neg (n=127)`````34.0%```````25.7%```````8.3%
----------------------------------------------------------------
Overall``````````39%`````````23%```````15.9%
Dr. Strayer concluded that there was a 70% greater than average exercise response in XMRV+ subjects, and a 40% lower response in those who were XMRV-.
----------------------------------------------------------------
XMRV Status``|Improved``|`Improved````|Difference
``````````````on Ampligen``with placebo``(AMP-PBO)
----------------------------------------------------------------
Pos (n=81)``````44.7%```````17.6%``````27.1%
----------------------------------------------------------------
Neg (n=127)`````34.0%```````25.7%```````8.3%
----------------------------------------------------------------
Overall``````````39%`````````23%```````15.9%
Dr. Strayer concluded that there was a 70% greater than average exercise response in XMRV+ subjects, and a 40% lower response in those who were XMRV-.
Medication use was monitored in all of these subjects as well. 53% of XMRV+ subjects were able to reduce their use of symptomatic medications, while only 32% of XMRV- subjects were able to reduce medication use.
These data suggest that subjects who are XMRV+ have an edge in responding to Ampligen, and that Ampligen may be a treatment for CFS. Strayer reported plans by Hemispherx to monitor this in the current cost recovery (AMP-511) program, and hopefully to generate another large double blind placebo-controlled crossover study.
What Is Ampligen?
Ampligen is a poly-nucleic acid medication that has been studied for over two decades, but not yet FDA-approved for treating any disorder.
It was found in the 1980's to be effective in treating Chronic Fatigue Syndrome symptoms, and subsequently underwent several trials in the US and abroad.
Based on these results a new drug application was filed with the FDA in 2009, and in December of that year their Complete Letter of Response indicated that Ampligen was "approvable" but requested that more subjects be treated to assure safety and efficacy.
So far over 90,000 doses of Ampligen have been administered to over 900 subjects.
Ampligen has unique properties. It is a selective Toll Receptor (TLR3) agonist with immunomodulatory, anti-proliferative, and anti-viral properties. The drug:
*Increases interferon a and b
*Restores TH2 immunity to the (more normal) TH1 type
*Activates the immune response (e.g.,against HIV and renal carcinoma)
*Increases LAK and NK Cell activity
*Induces dendritic cell maturation(thus IgA and some IgG)
*Increases macrophage activity
*Restores delayed-type hypersensitivity
*Has antiviral effects versus retroviruses, HHV6, and RNA viruses.
This drug is administered intravenously twice weekly for at least 6 months. Side effects are mostly flu-like in nature, and overall the drug has been tolerated extremely well.
While Ampligen is not considered a cure for CFS, published studies have demonstrated improvement in duration of exercise on a treadmill and a reduction in use of concomitant medications.
Actuarial studies suggest that Ampligen treatment saves about $5000 per year in medical expenses. Dr. Lapp has been involved with Ampligen studies since 1988, and our personal experience at Hunter-Hopkins with the current AMP-511 study has been that about one third of subjects achieve very significant global improvement.
Ampligen is currently available only at Hunter-Hopkins and Dr. Peterson's Lake Tahoe clinic. Dr. Bateman's Fatigue Consultation Clinic in Salt Lake City will soon resume treatments, and Hemispherx is planning to add several other sites around the US, in addition to sites in Mexico and Argentina.
For more information check out our website (www.drlapp.net >Research> Ampligen), Clinical Trials (http://clinicaltrials.gov >search for study NCT00215813), and the Hemispherx Biopharma website at www.hemispherx.net.
For application to the AMP-511 Cost Recovery Study, contact our research coordinator, Wendy Fallick, at 704 5439692.
Because AMP-511 is a treatment protocol and not a drug study, insurance may cover some or all of the expenses involved.
We owe a great debt of gratitude to Dr. William Carter and Hemispherx Biopharma for developing Ampligen – the only proposed treatment for CFS – and supporting research in CFS for over 22 years. I know that Dr. Carter, his colleagues, and his company have experienced the same kind of humiliation and disdain that all of us involved with CFS have experienced, and it is a testament to their courage and determination that they have endured all these years when they could have abandoned CFS for more lucrative areas.
This newsletter is published periodically by Hunter-Hopkins Center, P.A., 7421 Carmel Executive Park,Charlotte, North Carolina 28226, USA..Telephone (704) 543 9692, Fax (704) 543 8547.
XMRV and Prostate Cancer
fulltext- http://downloads.mts.hindawi.com/MTS-Files/AV/papers/XMLV/432837.v2.pdf?AWSAccessKeyId=0CX53QQSTHRYZZQRKA02&Expires=1306368114&Signature=aDnt%2BW%2BZBM45pkDbjGNTYakvSKY%3D
XMRV Discovery and Prostate Cancer Related Research
David E. Kang1,2, Michael C. Lee1,2, Jaydip Das Gupta2, Eric A.
Klein1,2,3, and Robert H. Silverman2,3
1Glickman Urological and Kidney Institute, 2Department of Cancer
Biology, Lerner Research Institute, and 3Taussig Cancer Center,
Cleveland Clinic, 9500 Euclid Avenue, Cleveland, OH 44195
*Corresponding author: Robert H. Silverman, Cleveland Clinic, 9500
Euclid Avenue NB40, Cleveland, OH 44195. Telephone: 216-445-9650, Fax:
216-445- 6269, e-mail: silverr@ccf.org
Abstract-
Xenotropic murine leukemia virus-related virus (XMRV) was first
reported in 2006 in a study of human prostate cancer patients with
genetic variants of the antiviral enzyme, RNase L. Subsequent
investigations in North America, Europe, Asia and Africa have either
observed or failed to detect XMRV in patients [prostate cancer,
chronic fatigue syndrome-myalgic encephalomyelitis (CFS-ME),
immunosuppressed with respiratory tract infections] or normal, healthy
control individuals. The principal confounding factors are the near
ubiquitous presence of mouse derived reagents, antibodies and cells,
and often XMRV itself, in laboratories. XMRV infects and replicates
well in many human cell lines, but especially in certain prostate
cancer cell lines. XMRV also traffics to prostate in a non-human
primate model of infection. Here we will review the discovery of XMRV
and then focus on prostate cancer related research involving this
intriguing virus.
XMRV Discovery and Prostate Cancer Related Research
David E. Kang1,2, Michael C. Lee1,2, Jaydip Das Gupta2, Eric A.
Klein1,2,3, and Robert H. Silverman2,3
1Glickman Urological and Kidney Institute, 2Department of Cancer
Biology, Lerner Research Institute, and 3Taussig Cancer Center,
Cleveland Clinic, 9500 Euclid Avenue, Cleveland, OH 44195
*Corresponding author: Robert H. Silverman, Cleveland Clinic, 9500
Euclid Avenue NB40, Cleveland, OH 44195. Telephone: 216-445-9650, Fax:
216-445- 6269, e-mail: silverr@ccf.org
Abstract-
Xenotropic murine leukemia virus-related virus (XMRV) was first
reported in 2006 in a study of human prostate cancer patients with
genetic variants of the antiviral enzyme, RNase L. Subsequent
investigations in North America, Europe, Asia and Africa have either
observed or failed to detect XMRV in patients [prostate cancer,
chronic fatigue syndrome-myalgic encephalomyelitis (CFS-ME),
immunosuppressed with respiratory tract infections] or normal, healthy
control individuals. The principal confounding factors are the near
ubiquitous presence of mouse derived reagents, antibodies and cells,
and often XMRV itself, in laboratories. XMRV infects and replicates
well in many human cell lines, but especially in certain prostate
cancer cell lines. XMRV also traffics to prostate in a non-human
primate model of infection. Here we will review the discovery of XMRV
and then focus on prostate cancer related research involving this
intriguing virus.
Thursday, June 9, 2011
Doctor Causes Heart Attack
(this report has not been verified, and is simply passed along as a warning of what may happen when dealing with doctors who don't know what they're doing)
Nearly 1 In 7 People On Earth Is Disabled, Survey Finds
That's a billion people. We should have a bigger voice than we do.
Wednesday, June 8, 2011
Why Fibromyalgia Has a Credibility Problem
Note: Fibromyalgia, like CFS and GWS, is part of series of long
standing skirmishes between social medicine and biomedicine (aka the
germ theory model). Fans of the unprovable theory of social medicine's
so-called medicalization theory, such as Dr. Nortin Hadler, believe
fibromyalgia is the "medicalization of misery," but offer no objective
evidence that they are correct. Many rely on the lack of biomedical
evidence or conflicting evidence as proof although absence of proof is
not necessarily considered proof of absence. Others, particularly
early on, argued that if the word fibromyalgia were removed from the
vocabulary of patients, the disease would cease to exist. They offered
no definitive proof of this hypothesis either however. On the
biomedical side the objective biomedical evidence continues to mounts
as scientists learn more about the biological underpinnings of pain.
JOURNEY: SYMPTOMS AND DIAGNOSIS
Why Fibromyalgia Has a Credibility Problem
On top of their daily struggle with pain, fibromyalgia patients are
sometimes forced to fight another battle—convincing doctors, friends,
coworkers, and others that their condition is real and that their pain
is not all in their head.
Women suffer disproportionately from fibromyalgia, the symptoms are
complex, and there is no cure. For these reasons, many patients and
some doctors say that fibromyalgia is under-recognized and
undertreated in the U.S.
"It was maddening. I felt like most of the doctors I saw were not
acknowledging that I was really in pain," says Shelley Kirkpatrick,
32, of Bellefontaine, Ohio, who began experiencing fatigue and
excruciating joint and muscle pain in 2004.
"I felt they were thinking I was exaggerating my symptoms or that I
was making them up entirely," says Kirkpatrick. "Even to the point
where I saw a neurologist who told my husband to take me to a
psychiatrist because there was nothing wrong with me."
Finally after two years of fruitless tests, her doctor told her she
had fibromyalgia...
The full version can be read here:
http://www.health.com/health/condition-article/0,,20326403_1,00.html
standing skirmishes between social medicine and biomedicine (aka the
germ theory model). Fans of the unprovable theory of social medicine's
so-called medicalization theory, such as Dr. Nortin Hadler, believe
fibromyalgia is the "medicalization of misery," but offer no objective
evidence that they are correct. Many rely on the lack of biomedical
evidence or conflicting evidence as proof although absence of proof is
not necessarily considered proof of absence. Others, particularly
early on, argued that if the word fibromyalgia were removed from the
vocabulary of patients, the disease would cease to exist. They offered
no definitive proof of this hypothesis either however. On the
biomedical side the objective biomedical evidence continues to mounts
as scientists learn more about the biological underpinnings of pain.
JOURNEY: SYMPTOMS AND DIAGNOSIS
Why Fibromyalgia Has a Credibility Problem
On top of their daily struggle with pain, fibromyalgia patients are
sometimes forced to fight another battle—convincing doctors, friends,
coworkers, and others that their condition is real and that their pain
is not all in their head.
Women suffer disproportionately from fibromyalgia, the symptoms are
complex, and there is no cure. For these reasons, many patients and
some doctors say that fibromyalgia is under-recognized and
undertreated in the U.S.
"It was maddening. I felt like most of the doctors I saw were not
acknowledging that I was really in pain," says Shelley Kirkpatrick,
32, of Bellefontaine, Ohio, who began experiencing fatigue and
excruciating joint and muscle pain in 2004.
"I felt they were thinking I was exaggerating my symptoms or that I
was making them up entirely," says Kirkpatrick. "Even to the point
where I saw a neurologist who told my husband to take me to a
psychiatrist because there was nothing wrong with me."
Finally after two years of fruitless tests, her doctor told her she
had fibromyalgia...
The full version can be read here:
http://www.health.com/health/condition-article/0,,20326403_1,00.html
* * *
"if the word fibromyalgia were removed from the vocabulary of patients, the disease would cease to exist" Really? How many of us had the problem before we knew there was a name for it?
Does it count if you're accomplishing things while in bed?
Doctor – and patient – Devin Starlanyl MD notes that it's remarkable how much patients accomplish despite their illness. "The fact that you function at all with fibromyalgia is often a miracle." And it's true. So many of us were Type A's when we were healthy that the idea of doing nothing all day is foreign to us.
Because we are not able to commute to someone else's office, Vocational Rehabilitation generally wants nothing doing with us.
Flat on my back, I started two businesses, one of which is still up and running today.
The other was a website concocted in partnership with a disabled friend. At the time, I had blinding headaches and couldn't sit up for more than a few minutes without passing out. She did all the coding and website design, and I wrote articles. Scads of articles. Lying down, lights out, eyes closed, touch-typing on a laptop computer. At some point I'd feel enough better to pry open one eye for a minute to proofread, and send the articles to her to post on the website.
Since I couldn't look at the computer screen for long, they weren't well-researched enough to be sold to a magazine. They were strictly based on my own experience and expertise.
Small problem, both partners being disabled, we didn't have enough money to advertise the website, so after all the work we'd put into it, we weren't able to generate enough interest to make it a financial success.
Yet, so many people couldn't make the connection that what I was doing for our own website was not proof that I could work for pay – I got plenty of accusations "if you can sit at a computer at home, why can't you sit at a computer in an office?" Ummmmm, because I'm not sitting. No office is going to give me a bed. I'd previously fought – and lost – the battle of keeping the fluorescent light fixture over my desk dark to minimize my headaches; ADA be damned, it "looked sloppy, like maintenance isn't doing their job". Just like a bed with laptop would probably be a reasonable ADA accommodation, but no new employer is going to give it to me without a long legal battle because of the perception that someone who's lying down isn't working very hard. Anyway, you have to get hired in order to demand ADA accommodations, and I was too sick to make a good impression in an interview, so I wasn't getting hired. Interviewers saw symptoms and asked "honestly, can you do the job?" and, honestly, I couldn't say Yes.
But we have plenty of activists around the world who are making a difference from their beds. We can't get out to do in-person demonstrations like the ACT UP people did, but we can write letters and blogs, we can run websites, we can make phone calls, we can organize others to write and call...
Some years ago, I had a light-sensitive headache and had to lie down in a dark room. A fellow activist who was also spending the day in bed phoned to cheer me up. He made a difference in someone's life even though neither of us could leave our bed at that moment.
OK, the dishes aren't done. Breakfast was a Ritz Crackerfuls because the medication I took at bedtime left me too sluggish to get up to fix the omelette I had planned. Laundry is looking like it's going to get pushed back another day due to the medication-induced torpor. And I definitely don't feel up to chasing down the cat and wrestling her for a much-needed flea dip. But because I slept well thanks to the pills, I've been pretty productive today ... despite having not even gotten out of bed to use the bathroom yet, I've made a couple of phone calls, sent several e-mails, advised a couple of fellow patients, posted some information to both this blog and the CFS Facts Facebook page, pre-written a Bloggerama Day blog post as well as this one, downloaded a podcast. All without leaving the bed. And compared to how I felt 10 years ago when I couldn't even sit up, thanks to the pills I woke up today feeling rested, human, as close to "normal" as I'm likely ever going to get.
But then I read Facebook and realize how much of life passes me by. Friends who think nothing of planning three things per day for both days of the weekend ... I haven't been able to plan both days of a weekend since 1987, because I needed to allot one of them for resting on the couch. Friends who are going to do some gardening in the morning and do something else in the afternoon ... when I do far less gardening than she will (because my yard is postage-stamp-sized – she has just one flower bed larger than my entire yard) I'll be in bed for days, not running off after a quick shower to do something else physical for the rest of the day.
It's been so long since I was normal, that I've forgotten what normal is like. As I was sliding into this relapse in early 2000, I argued with a (wiser) friend that I couldn't be sick, I'd recently gone to Target. She asked what else I did that day. Ummmmm, to be brutally honest, I came home from Target, collapsed, and had flulike symptoms for weeks afterward. She pointed out the incredibly obvious, that I'd been complaining about "the flu" for six months, the flu does not last for months, smacked me upside the head that I was in denial about relapsing. Just as I was starting to feel better, I spent a week visiting a friend, and again, came home with flulike symptoms, plus carrying luggage left my hand/arm muscles weakened.
I do as much as I can during the day, a list which sounds pretty impressive to my fellow patients, but the reality is, if someone were paying me to work, the daily total output would fall below expected productivity. Factor in the number of days I'm too sick to work and I'd soon lose the job.
MS, CFS and Fatigue
Research showing that at least 29% of MS patients had a prior CFS diagnosis or report of disabling fatigue, presented at the 25th Consortium of MS Centers annual meeting. This Medscape article recaps the report: http://www.medscape.com/viewar ticle/744198?src=smo (Free registration required to view.)
‘Science asks researchers to withdraw paper on chronic fatigue syndrome
Here's the facts to base your bloggerama post on....
What time?
If you're confused about when 1 PM Eastern on Friday is in your time zone, select USA - New York as the place to convert from and enter your location as the place to convert to.
Month June Date 10 Year 2011 Hour 13 / 1 PM
Voila!
XMRV Bloggerama on Friday
Friday, June 10 -- aim to have your article hit your blog at 1 PM Eastern/10 AM Pacific for maximum impact on those search engines that track trending.
Suggested topic du jour, Science demanding retraction of the XMRV paper. Even if you're not writing about that, please put the word "XMRV" somewhere in your blog post so it tracks.
Tuesday, June 7, 2011
A whole lot of nothing
Deb Waroff comments "You know the trouble with this disease? All this time goes by with nothing in it. You don't get a chance to put anything in it. It's just empty time."
Someone who doesn't know how sick I've been – doesn't need to know – observed that I talk a lot about what I did as a teenager, rarely about what I've done as an adult.
It's hard to explain to a healthy person that you haven't actually done much as an adult. You went to work, then came home and collapsed until it was time to go to work the next day. On three-day holiday weekends when your friends went skiing or shopping or to a nearby city to do sightseeing, you thanked God for an extra day to rest up on the couch. Very few Monday holidays that I budged off the couch for more than essentials like bathroom and food.
And that was when I was well enough to go to work.
And that was when I was well enough to go to work.
I recently saw that someone had graduated in 1995 and dismissed him as a young'un. Till the next time I saw the current date and realized that I've lost a whole decade. For me, time stopped in 2000. I spent most of the next several years horizontal, doing nothing, going nowhere, because a trip to the grocery store was enough to send me back to bed till the following weekend when I again was driven to the grocery store (if I was up to it, which I sometimes wasn't).
I was too sick to go to movies and if I turned one on on TV, odds were I zoned out before it was over, and next morning didn't even remember what little of it I did see.
Books? Too sick to go to the library and if I took one off my shelf, I'd get to page 5 and have to look back at page 1 to figure out who Sue was. Oh, she's the main character. I couldn't remember the plot any better than I could remember the characters, so it was pointless to read anything more complicated than the comics page.
Needlework? I did a very simple piece and when I looked at it on a rare good day, it looked like something done by a beginner.
Mostly I laid in bed and prayed to either get better or die, rather than endure more of this endless Night of the Living Dead.
I've improved to the point I can occasionally go out and do something more than shop for a few basic groceries, come home and collapse. I'm feeling well enough this week that I should be able to go for groceries one day and to the pharmacy on another day, instead of having to choose between them, which is the most crucial errand this week? You'll note the two excursions I have planned are essential errands: not a concert, not out to lunch with friends, not meandering around the mall.
Nothing worth telling anyone about when they ask what I've been up to. But nonetheless a vast improvement over 10 years ago when sometimes I went weeks between excursions out of the house because I passed out when I got off the horizontal.
Sunday, June 5, 2011
How Your Immune System Plays Into Arthritis - Arthritis Center
Reactive arthritis. This is a disease that occurs as a result of another infection. While the cause isn't exactly understood, the inflammation that results could come from an exaggerated immune system response to the infection; the inflammation starts as the rest of the body heals.
Innovation – Global Public Square
"Ultimately, innovation cannot work without both significant government support and a vibrant and dynamic private sector that allows people to experiment, fail and try again." - Fareed Zakaria
Voices from the Shadows
For people who think the link doesn't work (if it didn't), one has to paste
the two bits together.
Here's a short link: http://on.fb.me/muyQGk
The trailer is 3 minutes so not too long - direct link:
http://vimeo.com/24683179
Tom
-----Original Message-----
From: ME/CFS and Fibromyalgia Information Exchange Forum
[mailto:CO-CURE@LISTSERV.NODAK.EDU] On Behalf Of Greg crowhurst
*Voices From the Shadows*
Trailer for the upcoming documentary; Voices from the shadows', a
compassionate and moving exposé, bearing witness to the devastating
consequences of psychiatric prejudice and medical ignorance about one of the
most prevalent illness of the 21st Century.
Probably the most powerful ME film you will ever see .
Watch , weep and speak-out about the injustice that you and the people you
know are experiencing daily. Things must change.
This film will shock, horrify, enlighten and move you to tears; it
highlights the abuse and neglect of people with ME, as no other film has
ever done.
The trailer has just been released on Facebook :
https://www.facebook.com/pages/Voices-from-the-Shadows/
113252708761601?sk=wall
--
Greg Crowhurst
www.stonebird.co.uk
(The Lived Experience of Severe ME)
the two bits together.
Here's a short link: http://on.fb.me/muyQGk
The trailer is 3 minutes so not too long - direct link:
http://vimeo.com/24683179
Tom
-----Original Message-----
From: ME/CFS and Fibromyalgia Information Exchange Forum
[mailto:CO-CURE@LISTSERV.NODAK.EDU] On Behalf Of Greg crowhurst
*Voices From the Shadows*
Trailer for the upcoming documentary; Voices from the shadows', a
compassionate and moving exposé, bearing witness to the devastating
consequences of psychiatric prejudice and medical ignorance about one of the
most prevalent illness of the 21st Century.
Probably the most powerful ME film you will ever see .
Watch , weep and speak-out about the injustice that you and the people you
know are experiencing daily. Things must change.
This film will shock, horrify, enlighten and move you to tears; it
highlights the abuse and neglect of people with ME, as no other film has
ever done.
The trailer has just been released on Facebook :
https://www.facebook.com/pages/Voices-from-the-Shadows/
113252708761601?sk=wall
--
Greg Crowhurst
www.stonebird.co.uk
(The Lived Experience of Severe ME)
I see no ships: New Labour Health Policy and Myagic Encephalomyelitis
"I see no ships" is in fact a misquote attributed to Admiral Horatio Nelson who, during the battle of Copenhagen in 1801, theatrically raised his telescope to his blind eye in order to ignore fleet signals and press on to attack his quarry: a very apt parallel for the world of ME politics.
Subscribe to:
Posts (Atom)
Restricted infection of xenotropic murine leukemia virus-related virus in human lymphoid tissue
http://www.retrovirology.com/c...
Absence of xenotropic murine leukaemia virus-related virus in Danish patients with multiple sclerosis
http://www.retrovirology.com/c...
Heme oxygenase-1 activation inhibits XMRV pathogenesis and carcinogenesis in prostate cancer cells
http://www.retrovirology.com/c...
XMRV replicates preferentially in mucosal sites in vivo: Relevance to XMRV transmission?
http://www.retrovirology.com/c...
A prototype RT-PCR assay for detection of XMRV in multiple human sample types
http://www.retrovirology.com/c...
Immune correlates of XMRV infection (Lombardi, Mikovits, etc)
http://www.retrovirology.com/c...
Prevalence of XMRV in blood donors, HTLV and HIV cohorts
http://www.retrovirology.com/c...
The effects of XMRV gene expression on the mouse prostate
http://www.retrovirology.com/c...
XMRV: usage of receptors and potential co-receptors
http://www.retrovirology.com/c...
Cell line tropism and replication of XMRV
http://www.retrovirology.com/c...
Structure of the xenotropic murine leukaemia virus-related virus matrix protein
http://www.retrovirology.com/c...
Development of XMRV producing B Cell lines from lymphomas from patients
with Chronic Fatigue Syndrome (Ruscetti, Mikovits and others)
http://www.retrovirology.com/c...
Multi-laboratory evaluations of XMRV nucleic acid (BWG report)
http://www.retrovirology.com/c...
Serologic and PCR testing of persons with chronic fatigue syndrome in
the United States shows no association with xenotropic or polytropic
murine leukemia virus-related virus
http://www.retrovirology.com/c...
XMRV infection in human diseases
Otto Erlwein , Mark J Robinson, Steve Kaye, Myra O McClure, Marjorie M
Walker, Anup Patel, Wun-Jae Kim, Mongkol Uiprasertkul, Ganesh
Gopalakrishnan, Takahiro Kimura and Kikkeri Naresh
http://www.retrovirology.com/c...
Murine leukemia viruses (MuLV) and Xenotropic MuLV-related viruses exhibit inter-tropic complex recombination patterns
Mattia CF Prosperi , William M Switzer, Walid Heneine and Marco Salemi
http://www.retrovirology.com/c...
Detection of MLV-like gag sequences in blood samples from a New York state CFS cohort
Maureen R Hanson , Li L Lee, Lin Lin, David E Bell, David Ruppert and David S Bell
http://www.retrovirology.com/c...
Human infection or lab artifact: will the real XMRV please stand up?
Robert H Silverman
http://www.retrovirology.com/c...