Source: Molecular Medicine Uncorrected ProofDate: November 16, 2008URL:
http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=2583111&blobtype=pdf http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=19015737 Rem: Running title: Complement activation in chronic fatigue syndrome Transcriptional control of complement activation in an exercise model ofChronic Fatigue Syndrome------------------------------------------------------------------------Bristol Sorensen(1), James F. Jones, Suzanne D. Vernon(2), Mangalathu S.Rajeevan(3)- Division of Viral and Rickettsial Diseases, National Center for Zoonotic, Vector-borne and Enteric Diseases, Centers for Disease Control and Prevention, Atlanta, GA, USA 30333;1 Department of Integrative Biology, University of Colorado at Boulder, Boulder, CO;2 The CFIDS Association of America, 6827 Fairview Road, Suite A, Charlotte, North Carolina 28210 3 Author for correspondence: Mangalathu S. Rajeevan, Centers for Disease Control and Prevention, 1600 Clifton Road, MSG 41, Atlanta, GA, USA 30333 Ph 404-639-2931, Fax 404-639-3540; E-mail:
mor4@cdc.gov ABSTRACTComplement activation resulting in significant increase of C4a split productmay be a marker of post-exertional malaise in chronic fatigue syndrome (CFS)subjects. This study was focused to identify the transcriptional control thatmay contribute to the increased C4a in CFS subjects post-exercise.Differential expression of genes in the classical and lectin pathways wereevaluated in peripheral blood mononuclear cells (PBMCs) using quantitativereverse transcription PCR. Calibrated expression values were normalized tointernal (peptidylpropyl isomerase B [PPIB]) or external (ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit [rbcL]) reference genesor geometric mean (GM) of genes ribosomal protein, large, P0 (RPLP0) andphosphoglycerate kinase 1 (PGK1). All nine genes tested, exceptmannose-binding lectin 2 (MBL2), were expressed in PBMCs. At 1 hrpost-exercise, C4, mannan-binding lectin serine protease 2 (MASP2) andficolin 1 (FCN1) transcripts were detected at higher levels ( 2-fold) in atleast 50% (4 out of 8) of CFS subjects that increased to 88% (7 out of 8) CFSsubjects when subjects with over-expression of either C4 or MASP2 werecombined. Only increase in MASP2 transcript was statistically significant[PPIB, p=0.001; GM, p=0.047; rbcL, p=0.045]). This may be due to thesignificant but transient down-regulation of MASP2 in control subjects (PPIB,p=0.023; rbcL, p=0.027). By 6 hrs post-exercise, MASP2 expression was similarin both groups. In conclusion, lectin pathway responded to exercisedifferentially between CFS and controls subjects. MASP2 down-regulation mayact as an anti-inflammatory acute-phase response in healthy subjects, whereasits elevated level may account for increased C4a and inflammation mediatedpost-exertional malaise in CFS subjects.Key words: Post-exertional malaise; C4a split product; Gene expression;Classical and lectin pathways; InflammationINTRODUCTIONChronic fatigue syndrome (CFS) is a medically unexplained illness identifiedby self-reported symptoms and exclusionary conditions. Efforts to identifydiagnostic markers for CFS remain challenging. Discovery of biomarkers mayhave been impeded by the fact that the unique biologic changes responsiblefor the original illness production may no longer be present in mostprevalent cases of CFS identified by various clinical case definitions (1,2).However, a consistently observed case defining symptom in CFS subjects is theexacerbation of symptoms following exercise (post-exertional malaise) asopposed to the relief from symptoms following exercise in patients with otherfatigue-associated conditions like depression, rheumatoid arthritis, systemiclupus erthymatosus and multiple sclerosis (3-6). Further, post-exertionalmalaise was one of the key symptoms in the Centers for Disease Control (CDC)symptom inventory list that differentiated subjects with chronic fatigue fromnon-fatigued subjects (7). In a principle component analysis to delineateheterogeneity in medically unexplained fatiguing illness, post-exertionalmalaise was the highest loading factor among a data set of 38 independentclinical and laboratory measurements (8). Thus, available evidence indicatespost-exertional malaise to be a unique and a major case defining symptom,necessitating focused studies on its clinical and molecular characterization.Identification of specific biologic changes associated with post-exertionalmalaise offers a promising approach for the discovery of biomarkers of CFS.Since clinical evaluation of patients with sickness behavior to identifyinfectious or inflammatory diseases indicated complement activation insubjects with CFS, we previously used an exercise paradigm to determinealterations in complement split products and found that exercise induced asignificant increase of C4a, a putative anaphylatoxin, at 6 hrs afterexercise only in CFS subjects (9). Mean symptom scores and mean scores forreduced activity and mental fatigue categories of Multidimensional FatigueInventory were also significantly increased in these CFS subjects followingexercise. Two complement split products universally accepted asanaphylatoxins, C3a and C5a, were not elevated in the CFS subjects. Amicroarray study with probes for 3800 genes and using total RNA fromperipheral mononuclear cells (PBMCs) of these subjects also identifieddifferences in complement activation between CFS and control subjectsfollowing exercise (10). Together, these results demonstrate that complementactivation may be a marker of CFS associated post-exertional malaise, andthat the exercise induced complement activation, particularly leading to theincreased level of C4a split product, may be regulated at the transcriptionallevel.C4a is generated from the cleavage of the native complement protein C4 viathe classical and lectin pathways. In the classical pathway, C4 is cleaved byC1s activated by C1q whereas in the lectin pathway, C4 is cleaved bymannan-binding lectin serine protease 2 (MASP2) activated by mannose bindinglectins (MBL) or ficolins (FCN). Some pro-inflammatory cytokines are known tomodulate the synthesis of the above proteins both at the mRNA and proteinlevels. C1q mRNA and proteins are reported to be stimulated byinterferon-gamma (IFN-gamma), IFN-alpha, IFN-beta, and interleukin-6 (IL-6) (11-13). The secretion of the serine protease C1s can be enhanced by eitherIFN-alpha or IFN-gamma (14). C4 expression both at the protein and mRNAlevels can be regulated by IFN-gamma, IFN-alpha, and IL-6(15-19). On anotherlevel, increased C4 may be available for cleavage if C1-inhibitor (SERPING1),which removes the active enzymes C1s and MASP-2 from their respectivecomplexes they form with C1q and ficolins, becomes transcriptionallyrepressed. Increased levels of C4a can thus be hypothesized to result fromany one or more transcriptional changes associated with increased amounts ofthe initiating proteins of the classical and/or lectin pathway, increasedamounts of pro-inflammatory cytokines that may stimulate the production ofthe initiating proteins of the complement pathway, or repression in theinhibitory regulation of the classical or lectin pathways. Based on the abovehypothesis, we examined changes in the expression of several genes in thecomplement pathway by real-time reverse transcription PCR (real-time RT-PCR)as the first step in testing the molecular basis of altered complementmetabolism following exercise.MATERIALS AND METHODSSubjects and blood collectionThe CDC Institutional Review Board, as required by the Department of Healthand Human Services regulations, approved the study. This study used a subsetof subjects (8 CFS and 7 Control) from a previous case-control study thatidentified a significant increase of C4a split product at 6 hrs post-exercisein CFS subjects (9). All subjects were recruited from the National JewishMedical and Research Center (NJMRC), Denver, CO. CFS subjects (mean age 37.5p/m 6.61 and 87.5% females) were volunteers from the outpatient consultationclinic of NJMRC whereas control subjects (mean age 28.3 p/m 3.80 and 43%females) were derived from the diagnostic complement laboratory of NJMRC. Except for 1 Asian subject in the control group, all study subjects wereCaucasians. It should, however, be noted that while age and sex of the CFSand control subjects were matched in the previous C4a split product study(9), this matching was not retained in the present study. Further, no attemptwas made to stratify the data based on age and gender because of the smallsample size, and report of no difference in the activation of complementpathways with regard to age or gender in normal healthy subjects (20). Allsubjects performed 20 minutes of a sub-maximal steady-state exercise on astationary bicycle ergometer. Blood was collected from all subjects byvenipuncture into tubes containing heparin immediately before exercise (T0 ),1 hour post-exercise (T1), and 6 hrs post-exercise (T2). PMBC's wereseparated from blood using Ficoll gradient and stored as pellets at -70 Cuntil used for RNA extraction.RNA isolation and quantificationTotal RNA was isolated from PBMCs using RNAqueous (Ambion Inc., Austin, TX)according to the manufacturer's recommendations, and stored at -70 C untiluse. RNA quality and quantity were determined using the RNA 6000 Nano Assaywith the Bioanalyzer (Agilent Technologies Inc., Palo Alto, CA). RNA qualitywas also assessed by denaturing agarose gel electrophoresis. All RNA sampleswere of good quality in terms of intactness of ribosomal bands as determinedby both the Bioanalyzer and agarose gel electrophoresis.LightCycler-based real-time RT-PCRLightCycler-based real-time RT-PCR with SYBR Green I dye detection andmelting curve analysis for product specificity was used to determine thetranscript levels. cDNA synthesisA 20 mul reverse transcription (RT) reaction was set up corresponding to eachsample using 0.5g of total RNA spiked with 1pg (300 copies/cell) of plantmRNA, ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL)(Strategene, LaJolla, CA) to determine the efficiency of RT-PCR reactions ingeneral, and as an external reference gene for normalization of geneexpression. A single tube reaction method was used to treat total RNA withDNase I to remove traces of contaminating DNA (21). Total RNA containingplant mRNA spike was digested with 4 units of DNase I (MessageClean Kit,GenHunter Corp., Nashville, TN ) in 12.8 mul reaction that contained 1.8 mul5X first strand RT buffer (Clontech, Palo Alto, CA). DNase I digestion wasperformed for 30 minutes at 37 C, and terminated at 72 C for 2 minutesfollowed by incubating on ice immediately. One microliter of DNase I treatedRNA was removed, diluted 1:10 with water, and set aside as no-RT controltemplate for PCR to determine the effectiveness of DNase I treatment. Theremainder of the DNase I treated RNA was supplied with 300 ng of randomhexamers (Invitrogen, Carlsbad, CA), and incubated at 72 C for 10 minutes andthen placed on ice. The reaction was finally brought up to 20 mul with 2.2mul of 5X first strand buffer (Clontech), 2 mul of 100 mM DTT, 2 mul of 10 mMdNTP (Invitrogen,) and 2 mul of PowerScript reverse transcriptase enzyme(Clontech). Each RT reaction was incubated at 42 C for 60 minutes, and thenterminated at 72 C for 15 minutes. To avoid degradation of RT product fromrepeated freezing and thawing, working stocks (1:5 dilutions of original RTproduct) were prepared in water, and stored at -20 C until used.Determination of LightCyler PCR conditions and setting up reactionsThe optimal annealing and signal acquisition temperatures for allgene-specific primers (Table 1) and product specificity were determined asdescribed earlier (22) with a calibrator cDNA synthesized as above usingUniversal Human Reference RNA (Strategene) mixed with total RNA from PBMCs ofhealthy volunteers. These optimal conditions enabled the signal acquisitionto be set 1-2 C below the Tm's of the specific product, minimizing signalinterference from non-specific products. PCR efficiency of each primer setwas determined using the optimal conditions and 2-fold serial dilutions(range 0.25 ng to 16 ng/PCR) of calibrator cDNA (Table 1).The LightCycler 2.0 Software version 4.0 (Roche Diagnostics Corp.,Indianapolis, IN) was used to set up the reactions. First, 2 mul of DNAMaster SYBR Green I mixture (containing Taq DNA polymerase, dNTP, MgCl_2 andSYBR Green I dye; Roche Molecular Biochemicals) was incubated with 0.16 mulof TaqStart Antibody (Clontech) for 5 minutes at room temperature prior tothe addition of primers and cDNA. Each final 20 mul reaction contained 2 mulof 1:2.5 dilution of cDNA working stock, 0.4 M each primer and 4 M MgCl2. Thethermal cycling conditions were as described previously (22) butincorporating the optimized annealing and signal acquisition temperatures foreach gene-specific primer (Table 1). Effectiveness of DNase I treatment wastested for all cDNA synthesis with primers for glyceraldehyde-3-phosphatedehydrogenase (GAPDH) and no-RT control template.Experimental design and statistical analysis:Determination of the fold differences in gene expression involved running 4separate experiments: experiment 1 to generate standard curve for target gene(run as absolute quantification) using calibrator cDNA; experiment 2 togenerate standard curve for reference genes (run in absolute quantification)using calibrator cDNA; experiment 3 for target gene amplification in unknownsamples along with calibrator cDNA (run in relative quantification, monocolormode); experiment 4 for reference gene amplification in unknown samples alongwith calibrator cDNA (run in relative quantification, monocolor mode). Datafrom all 4 runs were imported to the relative quantification application(monocolor) of the LightCycler software version 4 to determine efficiency-corrected crossing point (Cp) and normalized ratio as represented by theformula below. Normalized ratio = Target gene concentration /reference gene concentration in unknown sample = ------------------------------------------------------------------------- Target gene concentration/reference gene concentration in calibratorNormalized ratio to a calibrator sample (Universal Human Reference RNA,Stratagene) was derived to minimize LightCycler run to run variation asrecommended to assure uniformity from multiple runs and intra orinter-laboratory comparisons (23). Fold-difference in gene expression betweencases and controls were determined from their normalized ratios as determinedabove. Fold-differences were calculated with respect to normalized ratiosderived of individual endogenous reference (peptidylpropyl isomerase B[PPIB]) or external reference (rbcL) genes or using the geometric mean (GM)of the normalized ratios of the reference genes (ribosomal protein, large, P0[RPLP0] and phosphoglycerate kinase 1 [PGK1) determined by the g-Normsoftware. The rationale for these different normalization approaches usingPPIB (24) or external spike (25,26) or geometric mean (27) for real-timeRT-PCR has been published elsewhere.For the purpose of this study, we defined a gene as over or under-expressedif 50% or more of CFS subjects showed >= 2-fold change in expression comparedto the median of control group as determined by at least 2 of the 3normalization methods. Further, normalized ratios were log10 transformedprior to statistical analyses in StatView (Acton, MA, USA) to testsignificant differences (p-values <0.05) n="88;">= 2-fold over-expression ofeither C4 or MASP2 at T1 by at least 2 of the 3 normalization methods.On further analysis, only differential expression in MASP2 was statisticallysignificant between CFS and control groups at T1 using all 3 normalizationmethods (PPIB, p=0.001; GM, p=0.047; rbcL, p=0.045) (Figure 1A-C).Differential expression of C4 at T1 was significant (p=0.032) only with thedata normalized by the PPIB (Fig 1.D). It appears from this analysis (Fig 1A-D) that MASP2 and C4 in control healthy subjects were down regulated for atleast 1 hr post-exercise, followed by rise in their transcript levels to thebaseline by 6 hrs post-exercise. This down regulation at T1 compared to T0was significant only with MASP2 transcript levels normalized by PPIB (p =0.023) and rbcL methods (p=0.027), with borderline significance by GMnormalization (p=0.056). MASP2 transcript level at T2 did not differ betweenCFS and control subjects or when compared with T0 and T1 levels in both CFSand control subjects, except that the increase from T1 and T2 in controlsubjects was significant when transcript levels were normalized by the rbCLmethod (p=0.0143).DISCUSSIONThis study reports the first systematic evaluation of complement geneexpression in PBMCs. Of 9 complement genes tested, transcripts for all genesexcept MBL2 were detected in PBMCs indicating that complement gene activityis not restricted to specialized cells like hepatocytes. Lack of MBL2expression in PBMCs agrees with previous reports but MBL2 can be induced invitro in adherent monocyte and monocyte-derived dendritic cells (28). Whileexpression for some genes (C1Q, C4 and FCN1) was detected in PBMCs as inearlier reports (29-31), MASP2 expression was not detected previously inPBMCs (28). Initiation of classical pathway is antibody dependent but lectinpathway is antibody independent and begins with the recognition and bindingof sugars or N-acetyl groups on pathogenic cells (pathogen-associatedmolecular patterns) by MBL or ficolins. Based on the pattern of transcriptsdetected, genes belonging to both classical (C1QA, C1S) and lectin (ficolinsand MASP2) pathways are expressed in PBMCs, with the lectin pathway activatedby local synthesis of ficolins rather than MBL2.The major focus of this study was to determine if gene expression differencesin the complement system would correlate with the previous observation ofincreased C4a split product in CFS subjects 6 hrs post-exercise. Initialanalysis identified transcripts of C4, MASP2 and FCN1 at higher levels(>=2-fold) in at least 50% (4 out of 8) of CFS subjects at 1 hrpost-exercise, and the percentage of CFS subjects responding to complementgene expression increased to 88% (7 out of 8) when subjects withover-expression of either C4 or MASP2 were combined. Further analysis byt-tests identified significant difference in the level of MASP2 mRNA betweenCFS and control subjects at 1 hr post-exercise. This difference in MASP2 mRNAappears to be due to a significant but transient down-regulation in controlsubjects. By 6 hrs post-exercise, MASP2 expression was almost similar in bothgroups. This significant change in MASP2 expression at 1 hr post-exercise wasidentified independent of the method used for normalization, indicating thatthe observed role of MASP2 mediated lectin pathway in response to exercise islikely to be reproducible, in spite of the small sample size used in thisstudy. It may, however, be noted that the reference genes (RPLPO and PGK1)used in the GM normalization method may be targets to some extent, asindicated by the apparent inversion of MASP2 expression in CFS compared tocontrol subjects.The current data do not directly address the activation of complement systemduring or following exercise. Whatever the trigger, it may involve activationof monocytes since they may be a common source of C4, MASP2, and ficolins.Binding of ficolins in conjunction with MASP2 to C4 initiates cleavage of C4leading to the release of C4a (along with other components of the classicalpathway). Both FCN1 (M-ficolin) and FCN2 (L-ficolin), located in chromosome9q34 and separated by 22 kb, were detected in PBMCs with FCN1 expressed athigher level in PBMCs than FCN2 and also differentially expressed between CFSand control subjects. Although FCN1 has been until recently solely associatedwith monocytes, neutrophils, and spleen cells and hypothesized to be asecretory protein(32), it has recently been found in serum in lowconcentrations (33). If released by monocytes, FCN1 could bind to a varietyof its ligands, acetylated sugars or proteins, which are abundant during orfollowing exercise (34,35)Previous reports of serum or plasma levels of complement activation productssuggest that C activation takes place immediately with exhaustive exercise(36) but more slowly in the subjects in this study undergoing sub-maximalexercise (9). The trend of down-regulation of expression with return tobaseline levels in controls subjects that precedes by several hours theactivated proteins is in keeping with built-in regulatory processes inherentin the complement system. By contrast, expression of several complement genesremained at higher level in CFS subjects before and post-exercise indicatinga lack of acute phase transcriptional response by these genes which may leadto localized and uncontrollable inflammation mediated tissue damage (37). Thelectin pathway may also be activated by translocation of microbial productsfrom the gut postulated to occur during exercise (38) or other events such asinfection, injury or vaccine that can trigger local inflammation and avariety of autoimmune diseases (39). Either situation may lead to increasedC4a in CFS subjects compared to controls, and this C4a may have a regulatoryrole in inflammation by inhibiting monocyte chemotaxis (40) or throughfunctions similar to C3a "activator and inhibitor" sequences as proposed byErdei et al.( 2004)(41). An anti-inflammatory role would coincide with thedown-regulation of MASP2 expression in control subjects, 1 hr post-exercise.Mechanisms regulating the expression of MASP2 are currently unknown, exceptfor a report on a weak stimulatory effect by IL-1B that is abolished by IL-6(42), and a putative role for the transcription factor Stat 3 in itsexpression (43). Our bioinformatics analysis of MASP2 promoter byMatInpsector revealed several transcription factor binding sites includingtwo potential glucocorticoid responsive elements (GRE) located withinnucleotide positions -154 to -136, and between positions -989 to -971(positions numbered with respect to transcription start site). A central rolefor hypothalamic-pituitary-adrenal (HPA) axis in modulating post-exertionalmalaise in CFS subjects in the context of hypocortisolism has been discussedin the literature (44-46) without mechanistic explanations. Steroid treatmentstudies report a reduction or a general down-regulation of complementactivation by glucocorticoids (47-49). Based on the presence of GRE in MASP2promoter and glucocorticoid's anti-inflammatory response in general, it ishypothesized that in control subjects exercise induces cortisol secretionwhich inhibits MASP2 transcription through GRE, whereas at least in asubgroup of CFS subjects, exercise induced cortisol secretion is below athreshold (hypocortisolism) to inhibit MASP2 expression. Although cortisolwas not measured in this study, other studies have reported significantincrease in cortisol, and its correlation with post-exercise performance inhealthy subjects (50-53). Accumulating evidences suggest that physicalexercise, depending on the kind of exercise and subject characteristics, canact as a powerful modulator of HPA axis and influence central nervous systemfunctions in general (54,55). Complement system, either alone or interactingwith pro-inflammatory cytokines, may be a potential link in the bidirectionalcommunication between the HPA axis and immune functions that are likely to bealtered in subjects with CFS (56).Our findings should only be generalized in light of limitations of the studydesign. The previous study that reported the significant increase in C4asplit product (9) and the current study examining the transcriptional changesin complement genes used subjects from the same recruitment. Age and sex ofthe CFS and control subjects were matched in the C4a split product study butthis matching was not retained in the present study. We examined geneexpression changes in PBMCs, a non-invasive source of sample for biomarkerdiscovery and validation. PBMCs, however, are mixtures of lymphocytes andmonocytes, and as such the findings do not reflect cell-type specificresponses. Further, it remains to be addressed if the observedtranscriptional changes in complement genes are reflected in their plasmaprotein levels.In conclusion, this study detected expression of both classical and lectinpathways in PBMCs of normal healthy and CFS subjects, but transcripts forcomponents of the lectin pathway (C4 and MASP2) were observed at higher levelin CFS subjects 1 hr post-exercise. Higher expression of C4 and MASP2 maycontribute to the increased C4a split product in CFS subjects 6 hr postexercise. MASP2 expression was significantly down-regulated in controlsubjects 1 hr post-exercise, and this down-regulation may be mediated by theanti-inflammatory effect of cortisol in response to exercise. Further studiesare needed to replicate the differential expression of complement genes andits potential link with inflammation and cortisol secretion in response toexercise.ACKNOWLEDGMENTSSupport for B. Sorensen was provided by the research participation program atthe Centers for Disease Control and Prevention (CDC), National Center forZoonotic, Vector-borne and Enteric Diseases, Division of Viral andRickettsial Diseases, administered by the Oak Ridge Institute for Science andEducation through an interagency agreement between the U.S. Department ofEnergy and the CDC. The authors wish to acknowledge the laboratory support ofDr. Irina Dimulescu, bioinformatics support of Dr. Virginia Falkenberg andthe valuable comments and critical reading of the manuscript by Dr. ElizabethR. Unger.DISCLOSURESNo authors of this manuscript have any actual or potential conflict ofinterest including any financial, personal or other relationships with otherpeople or organizations that could inappropriately influence, or be perceivedto influence this work. The findings and conclusions in this report are thoseof the authors and do not necessarily represent the views of the fundingagency.FIGURE LEGENDFigure 1. Changes in the expression of MASP2 and C4 in CFS and control (CON)healthy subjects at baseline (T0) and at 1 hr (T1) and 6 hr (T2) followingexercise. (A) MASP2 expression level normalized by PPIB method. (B) MASP2expression normalized by geometric mean (GM) using g-Norm software. (C) MASP2expression normalized by external plant spike, rbcL transcript. (D) C4expression normalized by PPIB. P-values in bold indicate significantexpression differences in MASP2 and C4 between CFS and control subjects atT1. P-values in italics indicate significant difference in MASP2 expressionbetween different time points in response to exercise in control subjects.TABLESTable 1. Gene-specific primer sequences, LightCycler run conditions and PCR efficiencies.---------------------------------------------------------------------------------------------------Gene name GenBank Primer sequence (5'->3')^A Product Annealing/ PCR(Gene symbol) Accession# Size Acquisition Efficiency (bp) temperature---------------------------------------------------------------------------------------------------Complement component 1,q NM_015991 FW: GGCAGCCCAGGAAACATCAAGGAC 143 65/87 1.96 subcomponent, A chain RV: AATCGGCCGGAGTGGTTCTGGT (C1QA)Complement component 1,s NM_001734 FW: CATGGATGGGGACCTGGGACTGA 150 65/84 1.99 subcomponent (C1S) RV: GCCTCTGCATCTGCTGTGGGTTTCComplement component 4 NM_007293 FW: GGGGCCCCACGTCCTGCTGTAT 141 65/89 2.00 (C4) RV: CTGCGCTCGGGGTTGTAGTAGTCGMannose-binding lectin 2 NM_000242 FW: ACAAACTGGAACGAGGGTGAA 151 65/85 2.00 (MBL2) RV: CAGATGGGAGGTGGAGCAGMannan-binding lectin NM_006610 FW: TATGAAAAGCCACCCTATCCA 105 60/84 1.99 serine protease 2 RV: TGCCCCTCCGCTGTCAC (MASP2)Ficolin 1 (FCN1) NM_002003 FW: CGCCGACTGTCATGCTTCAAACCT 97 65/82 2.05 RV: GTACCCCTTCGCCGCACTCCAGFicolin 2 (FCN2) NM_004108 FW: GAACCAGCGAGCTCCGTGTAGACC 125 65/83 1.95 RV: GAAGGCCCCCAGGACCAGATTGTComplement component 1 NM_000062 FW: ACAGCAGCAGCCCCAGAGTCCTAA 100 65/84 1.97 inhibitor (SERPING1) RV: AGCCGGCTGATCTTGTTGTTGGTGInterferon gamma NM_000619 FW: TTGGGTTCTCTTGGCTGTTACTG 167 65/78 1.99 (IFN-gamma) RV: TGGCTCTGCATTATTTTTCTGTCAPeptidylpropyl isomerase M60857 FW: AAGGGGCCCAAAGTCACCGTCAAG 261 65/82 1.95 B (PPIB) RV: GGGGAAGCGCTCACCGTAGATGCPhosphoglycerate kinase NM_000291 FW: GCAGATTGTGTGGAATGGTC 101 65/81 1.98 1 (PGK1) RV: CCCTAGAAGTGGCTTTCACCRibosomal protein, large, NM_001002 FW: AAACTCTGCATTCTCGCTTCCTG 119 65/83 1.98 P0 (RPLPO) RV: GACTCGTTTGTACCCGTTGATGATEukaryotic elongation NM_001402 FW: TGCGGTGGGTGTCATCAAA 123 65/84 2.00 factor 1 (EEF1A1) RV: AAGAGTGGGGTGGCAGGTATTGRibulose -1,5-bisphosphate U91966 FW: ATTAGATGGCCAAGAGTAGATGAA 83 57/73 1.99 carboxylase/oxygenase RV: AAAAAGATTGAGCCGAGTGC large subunit (rbcL)Glyceraldehyde-3-phosphate X01677 FW: ACCACAGTCCATGCCATCAC 450 58/86 1.95 dehydrogenase (GAPDH) RV: TCCACCACCCTGTTGCTGTA---------------------------------------------------------------------------------------------------^A FW=forward primer; RV= reverse primerTable 2. Reproducibility of reference genes determined by coefficient of variation in Crossing points (Cp) ---------------------------------------------------------------------------Gene Symbol Mean Cp value p/m SD (n=88) Coefficient of variation ---------------------------------------------------------------------------EEF1A1 17.79 p/m 1.49 8.37 RPLP0 21.69 p/m 1.38 6.36 PGK1 25.20 p/m 1.67 6.64 PPIB 23.15 p/m 1.15 4.95 rbcL 25.33 p/m 0.66 2.61 --------------------------------------------------------------------------- Table 3. Over or under expression of complement genes as defined by 50% of CFS subjects that showed 2-fold expression changes in response to an exercise challenge compared to the median of control groupA.---------------------------------------------------------------------------Gene Normalization method ------------------------------------------------------------- PPIB GM rbcL ------------------- ------------------- ------------------- T0 T1 T2 T0 T1 T2 T0 T1 T2C1Q^A - 62.5 57.14 - - - 50.00 - -C1S - - - - 62.50 - - - -C4 - 75.00 - - 62.50 - - 62.50 -MASP2 62.50 62.50 57.14 - 50.00 - 50.00 62.50 -FCN1 - 62.50 - - 50.00 - - 62.50 -FCN2 50.00 50.00 - - - - - - -SERPING1 - - - 50.00 - - - - -IFN-gamma 62.50 - - 50.00 50.00 57.14 - - ----------------------------------------------------------------------------^A Only values for >=50% of CFS subjects that showed 2-fold differentialexpression compared to the median of the control group are shown. Hyphenatedcells indicate no differential expression. Values indicating down regulationare underlined. Because of a missing sample, values under T2 (in italics)indicate percentage with a denominator of 7 CFS subjects as opposed to T0 andT1 percentage values with a denominator of 8 CFS subjects. PPIB=normalization by the internal reference gene PPIB; GM=normalization bygeometric mean; rbcL=normalization by the external reference gene rbcL.T0=pre-exercise baseline, T1=1 hr post-exercise; T2=6 hr post-exercise. Numbers in lightly shaded cells indicate differential expression by MASP2 andIFN-gamma at T0 by at least two methods of normalization. Numbers in darklyshaded cells indicate differential expression in C4, MASP2 and FCN1 at T1 byall three normalization methods.Reference List1. Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. (1994) The chronic fatigue syndrome: a comprehensive approach to its definition and study. International Chronic Fatigue Syndrome Study Group. Ann.Intern. Med. 121:953-959.2. Reeves WC, Wagner D, Nisenbaum R, Jones JF et al. (2005) Chronic fatigue syndrome - a clinically empirical approach to its definition and study. BMC.Med. 3:19.3. Dunn AL, Trivedi MH, Kampert JB, Clark CG, Chambliss HO. (2005) Exercise treatment for depression: efficacy and dose response. Am.J.Prev.Med. 28: 1-8.4. Bearne LM, Scott DL, Hurley MV. (2002) Exercise can reverse quadriceps sensorimotor dysfunction that is associated with rheumatoid arthritis without exacerbating disease activity. Rheumatology (Oxford) 41:157-166.5. Robb-Nicholson LC, Daltroy L, Eaton H, et al. (1989) Effects of aerobic conditioning in lupus fatigue: a pilot study. Br.J.Rheumatol. 28:500-505.6. Mostert S, Kesselring J. (2002) Effects of a short-term exercise training program on aerobic fitness, fatigue, health perception and activity level of subjects with multiple sclerosis. Mult.Scler. 8:161-168.7. Wagner D, Nisenbaum R, Heim C, Jones JF, Unger ER, Reeves WC. (2005) Psychometric properties of the CDC Symptom Inventory for assessment of chronic fatigue syndrome. Popul.Health Metr. 3:8.8. Vollmer-Conna U, Aslakson E, White PD. (2006) An empirical delineation of the heterogeneity of chronic unexplained fatigue in women. Pharmacogenomics. 7:355-364.9. Sorensen B, Streib JE, Strand M, Make B, Giclas PC, Fleshner M, Jones JF. (2003) Complement activation in a model of chronic fatigue syndrome. J Allergy Clin Immunol. 112:397-403.10. Whistler T, Jones JF, Unger ER, Vernon SD. (2005) Exercise responsive genes measured in peripheral blood of women with chronic fatigue syndrome and matched control subjects. BMC.Physiol. 5:5.11. Gulati P, Lemercier C, Guc D, Lappin D, Whaley K. (1993) Regulation of the synthesis of C1 subcomponents and C1-inhibitor. Behring Inst.Mitt.196-203.12. Kolosov M, Kolosova I, Zhou A, Leu RW. (1996) Autocrine induction of macrophage synthesis of complement subcomponent C1q by endogenous interferon-alpha/beta. J.Interferon Cytokine Res. 16:209-215.13. Walker DG. (1998) Expression and regulation of complement C1q by human THP- 1-derived macrophages. Mol.Chem.Neuropathol. 34:197-218.14. Drouet C, Reboul A. (1989) Biosynthesis of C1r and C1s subcomponents. Behring Inst.Mitt.80-88.15. Collins T, Winkelstein JA, Sullivan KE. (1996) Regulation of early complement components C3 and C4 in the synovium. Clin.Diagn.Lab Immunol. 3:5-9.16. Kulics J, Circolo A, Strunk RC, Colten HR. (1994) Regulation of synthesis of complement protein C4 in human fibroblasts: cell- and gene-specific effects of cytokines and lipopolysaccharide. Immunology. 82:509-515.17. Sacks S, Zhou W, Campbell RD, Martin J. (1993) C3 and C4 gene expression and interferon-gamma-mediated regulation in human glomerular mesangial cells. Clin.Exp.Immunol. 93:411-417.18. Seelen MA, Brooimans RA, van der Woude FJ, van Es LA, Daha MR. (1993) IFN- gamma mediates stimulation of complement C4 biosynthesis in human proximal tubular epithelial cells. Kidney Int. 44:50-57.19. Vincent F, de la SH, Bohbot A, Bergerat JP, Hauptmann G, Oberling F. (1993) Synthesis and regulation of complement components by human monocytes/macrophages and by acute monocytic leukemia. DNA Cell Biol. 12: 415-423.20. Zimmermann-Nielsen E, Svehag SE, Thorlacius-Ussing O, Baatrup G. (2001) ELISA for evaluating the incorporation of plasma derived complement split- products C3b/iC3b into solid-phase immune complexes. J.Immunol.Methods. 249:43-5121. Huang Z, Fasco MJ, Kaminsky LS. (1996) Optimization of Dnase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR. Biotechniques. 20:1012-1020.22. Rajeevan MS, Ranamukhaarachchi DG, Vernon SD, Unger ER. (2001) Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods. 25:443-451.23. Skrzypski M. (2008) Quantitative reverse transcriptase real-time polymerase chain reaction (qRT-PCR) in translational oncology: Lung cancer perspective. Lung Cancer. 59:147-154.24. Pachot A, Blond JL, Mougin B, Miossec P. (2004) Peptidylpropyl isomerase B (PPIB): a suitable reference gene for mRNA quantification in peripheral whole blood. J.Biotechnol. 114:121-124.25. Bower NI, Moser RJ, Hill JR, Lehnert SA. (2007) Universal reference method for real-time PCR gene expression analysis of preimplantation embryos. Biotechniques. 42:199-206.26. Gilsbach R, Kouta M, Bonisch H, Bruss M. (2006) Comparison of in vitro and in vivo reference genes for internal standardization of real-time PCR data. Biotechniques. 40:173-177.27. Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA, Speleman F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH003428. Seyfarth J, Garred P, Madsen HO. (2006) Extra-hepatic transcription of the human mannose-binding lectin gene (mbl2) and the MBL-associated serine protease 1-3 genes. Mol.Immunol. 43:962-971.29. Fan Q, Weill B, Delpech M. (1994) Study of C4A mRNA in mononuclear blood cells from a patient with SLE and C4A homozygous deficiency without C4A gene deletion. Clin.Exp.Rheumatol. 12:657-660.30. Lu J, Le Y, Kon OL, Chan J, Lee SH. (1996) Biosynthesis of human ficolin, an Escherichia coli-binding protein, by monocytes: comparison with the synthesis of two macrophage-specific proteins, C1q and the mannose receptor. Immunology. 89:289-294.31. Moosig F, Damm F, Knorr-Spahr A, et al. (2006) Reduced expression of C1q- mRNA in monocytes from patients with systemic lupus erythematosus. Clin.Exp.Immunol. 146:409-416.32. Endo Y, Matsushita M, Fujita T. (2007) Role of ficolin in innate immunity and its molecular basis. Immunobiology. 212:371-379.33. Honore C, Rorvig S, Munthe-Fog L, Hummelshoj T, Madsen HO, Borregaard N, Garred P. (2008) The innate pattern recognition molecule Ficolin-1 is secreted by monocytes/macrophages and is circulating in human plasma. Mol. Immunol. 45:2782-2789.34. Watt MJ, Heigenhauser GJ, Dyck DJ, Spriet LL. (2002) Intramuscular triacylglycerol, glycogen and acetyl group metabolism during 4 h of moderate exercise in man. J.Physiol. 541:969-978.35. White LJ, Robergs RA, Sibbitt WL, Jr., Gasparovic CM, Petropoulos H, Brooks WM. (2006) Accumulation of acetyl groups following cycling: a 1H-MR spectroscopy study. Int.J.Sports Med. 27:100-104.36. Dufaux B, Order U. (1989) Complement activation after prolonged exercise. Clin Chim.Acta. 179:45-4937. Markiewski MM, Lambris JD. (2007) The role of complement in inflammatory diseases from behind the scenes into the spotlight. Am.J.Pathol. 171:715- 727.38. Shek PN, Shephard RJ. (1998) Physical exercise as a human model of limited inflammatory response. Can.J.Physiol Pharmacol. 76:589-597.39. Nancy AL, Shoenfeld Y. (2008) Chronic fatigue syndrome with autoantibodies - The result of an augmented adjuvant effect of hepatitis-B vaccine and silicone implant. Autoimmun.Rev. 8:52-55.40. Tsuruta T, Yamamoto T, Matsubara S, et al. (1993) Novel function of C4a anaphylatoxin. Release from monocytes of protein which inhibits monocyte chemotaxis. Am.J.Pathol. 142:1848-1857.41. Erdei A, Andrasfalvy M, Peterfy H, Toth G, Pecht I. (2004) Regulation of mast cell activation by complement-derived peptides. Immunol.Lett. 92:39- 42.42. Endo Y, Takahashi M, Kuraya M, Matsushita M, Stover CM, Schwaeble WJ, Fujita T. (2002) Functional characterization of human mannose-binding lectin-associated serine protease (MASP)-1/3 and MASP-2 promoters, and comparison with the C1s promoter. Int.Immunol. 14:1193-1201.43. Unterberger C, Hanson S, Klingenhoff A, et al. (2007) Stat3 is involved in control of MASP2 gene expression. Biochem.Biophys.Res.Commun. 364:1022- 1025.44. Baschetti R. (2005) Chronic fatigue syndrome, exercise, cortisol and lymphadenopathy. J.Intern.Med. 258:291-292.45. Glass JM, Lyden AK, Petzke F, et al. (2004) The effect of brief exercise cessation on pain, fatigue, and mood symptom development in healthy, fit individuals. J.Psychosom.Res. 57:391-398.46. Van Den EF, Moorkens G, Van HB, Cosyns P, Claes SJ. (2007) Hypothalamic- pituitary-adrenal axis function in chronic fatigue syndrome. Neuropsychobiology. 55:112-120.47. Ernst E, Espersen GT, Andersen MV. (1990) Reduction of complement activation in rheumatoid arthritis by steroid treatment. Int.J.Tissue React. 12:77-79.48. Packard BD, Weiler JM. (1983) Steroids inhibit activation of the alternative-amplification pathway of complement. Infect.Immun. 40:1011- 1014.49. Zimmermann-Nielsen E, Gronbaek H, Dahlerup JF, Baatrup G, Thorlacius- Ussing O. (2005) Complement activation capacity in plasma before and during high-dose prednisolone treatment and tapering in exacerbations of Crohn's disease and ulcerative colitis. BMC.Gastroenterol. 5:31.50. Li TL, Cheng PY. (2007) Alterations of immunoendocrine responses during the recovery period after acute prolonged cycling. Eur.J.Appl.Physiol. 101:539- 54651. Minetto MA, Lanfranco F, Baldi M, Termine A, Kuipers H, Ghigo E, Rainoldi A. (2007) Corticotroph axis sensitivity after exercise: comparison between elite athletes and sedentary subjects. J.Endocrinol.Invest. 30:215-223.52. Rojas VS, Struder HK, Vera WB, Schmidt A, Bloch W, Hollmann W. (2006) Acute BDNF and cortisol response to low intensity exercise and following ramp incremental exercise to exhaustion in humans. Brain Res. 1121:59-65.53. Minetto MA, Lanfranco F, Tibaudi A, Baldi M, Termine A, Ghigo E. (2008) Changes in awakening cortisol response and midnight salivary cortisol are sensitive markers of strenuous training-induced fatigue. J.Endocrinol. Invest. 31:16-24.54. Leal-Cerro A, Gippini A, Amaya MJ, Lage M, Mato JA, Dieguez C, Casanueva FF. (2003) Mechanisms underlying the neuroendocrine response to physical exercise. J.Endocrinol.Invest. 26:879-885.55. Dishman RK, Berthoud HR, Booth FW, et al. (2006) Neurobiology of exercise. Obesity (Silver.Spring). 14:345-356.56. Lorusso L, Mikhaylova SV, Capelli E, Ferrari D, Ngonga GK, Ricevuti G. (2008) Immunological aspects of chronic fatigue syndrome. Autoimmun.Rev. (Epub ahead of print).--------(c) 2008 The Feinstein Institute for Medical Research at North Shore LIJ
* * *
Another study that should be required reading for those doctors who tell CFS patients to exercise their way back to health and argue with the patients when they say that exercise makes them worse. It's not my imagination, I'm not making excuses because I don't like exercise -- there's objective evidence that CFS patients have an abnormal response to exercise.
Posts
